WormBase Tree Display for Variation: WBVar00094146
expand all nodes | collapse all nodes | view schema
WBVar00094146 | Name | Public_name | ok3065 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y23B4A.2.2:c.-6+87_165-18del | |||||||
HGVSg | CHROMOSOME_X:g.5919506_5920103del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y23B4A | ||||
Flanking_sequences | ttccttttctgtcttttattaatttccttt | aaaattttgtttttcagtaacaattccgaa | ||||||
Mapping_target | Y23B4A | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok3065_external | |||||||
ok3065_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032943 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00021268 | ||||||
Transcript | Y23B4A.2.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y23B4A.2.2:c.-6+87_165-18del | |||||||
Intron_number | 1-4/5 | |||||||
Exon_number | 2-4/6 | |||||||
Y23B4A.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2-3/4 | |||||||
Exon_number | 1-3/5 | |||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0002598 | Paper_evidence | WBPaper00059641 | ||||
Curator_confirmed | WBPerson10038 | |||||||
Remark | Quote from paper: "We first tested gustatory aversive learning of capa-1 mutants (Fig.4c) in the quadrant assay (Fig.5a). As expected, capa-1 animals were still attracted to NaCl after experiencing it in absence of food (Fig.5a). This learning defect did not result from general defects in salt chemotaxis behavior or in responses to osmotic stimuli (Supplementary Fig. 1a-c). Furthermore, capa-1 animals showed normal salt chemotaxis behavior when NaCl was paired with food but were defective in associating salt with different aversive experiences (Supplementary Fig. 1d, e)." | Paper_evidence | WBPaper00059641 | |||||
Curator_confirmed | WBPerson10038 | |||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00059641 | ||||
Curator_confirmed | WBPerson10038 | |||||||
Reference | WBPaper00059641 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |