WormBase Tree Display for Variation: WBVar00094193

WBVar00094193 Name: Public_name: ok3115
  Sequence_details: SMap: S_parent: Sequence: Y69A2AR
    Flanking_sequences: gaaaaaaaaaatacatgcgatagttttgcc atatattagctagaaattaccttcttactt
    Mapping_target: Y69A2AR
    Type_of_mutation: Insertion: T
      Deletion
    PCR_product: ok3115_external
      ok3115_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00032970
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00022099
      WBGene00174384
    Transcript: Y69A2AR.34
  Isolation: Mutagen: EMS
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00022099 Genomic_neighbourhood
  Method: KO_consortium_allele