WormBase Tree Display for Variation: WBVar00094257
expand all nodes | collapse all nodes | view schema
WBVar00094257 | Name | Public_name | ok3184 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C34F6.8.1:c.686_1128-121del | |||||||
HGVSg | CHROMOSOME_X:g.11217013_11217728del | |||||||
Sequence_details | SMap | S_parent | Sequence | C34F6 | ||||
Flanking_sequences | tccaatacgcattgatgaagcaatggccac | ctgtgggcaactttcacaacaattaaacaa | ||||||
Mapping_target | C34F6 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok3184_external | |||||||
ok3184_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00033024 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00007942 | ||||||
Transcript | C34F6.8.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C34F6.8.1:c.686_1128-121del | |||||||
cDNA_position | 692-? | |||||||
CDS_position | 686-? | |||||||
Protein_position | 229-? | |||||||
Intron_number | 4-6/7 | |||||||
Exon_number | 4-6/8 | |||||||
Interactor | WBInteraction000586290 | |||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype_not_observed | WBPhenotype:0001401 | Paper_evidence | WBPaper00059575 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | idh-2(ok3184) animals do not have enlarged mitochondria. | Paper_evidence | WBPaper00059575 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00059575 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00059575 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |