WormBase Tree Display for Variation: WBVar00094262

WBVar00094262 Name: Public_name: ok3191
    HGVSg: CHROMOSOME_I:g.5100653_5101038delinsCT
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_I
    Flanking_sequences: ttaactctctactgaacacccaatctcgct caaaatatcgcaggtacagtaccctcaagt
    Mapping_target: CHROMOSOME_I
    Type_of_mutation: Insertion: CT
      Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033029
    Laboratory: RB
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00016259
      WBGene00022465
    Transcript: Y110A7A.20.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2/4
        Exon_number: 1-2/5
      C30F8.3.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 1164-?
        Exon_number: 10/10
  Genetics: Interpolated_map_position: I -0.415599
  Remark: We have obtained the RB2353 strain (made by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation) from the CGC and sequenced the complete locus of ift-20. We found that there is a deletion of 386bps that includes part of the 5' UTR, all of the 1st exon, and part of the 1st intron.
    alt_det = 386bp deletion + 2bp (CT) insertion
  Method: Deletion_and_insertion_allele