WormBase Tree Display for Variation: WBVar00094634
expand all nodes | collapse all nodes | view schema
| WBVar00094634 | Evidence | Paper_evidence | WBPaper00024954 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | op236 | |||||
| Other_name | T23G11.3.1:c.826G>T | ||||||
| CE14096:p.Val276Phe | |||||||
| HGVSg | CHROMOSOME_I:g.7696756G>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | T23G11 | |||
| Flanking_sequences | aattgggagcatctcgaagacgatctgcac | ttcttgtgcaatgcgaagacactgagaatc | |||||
| Mapping_target | T23G11 | ||||||
| Type_of_mutation | Substitution | g | t | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00034664 | ||||||
| WBStrain00040676 | |||||||
| Laboratory | WS | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001595 | |||||
| Transcript | T23G11.3.1 (12) | ||||||
| Interactor | WBInteraction000502036 | ||||||
| WBInteraction000520821 | |||||||
| WBInteraction000520822 | |||||||
| WBInteraction000520823 | |||||||
| Genetics | Interpolated_map_position | I | 2.25213 | ||||
| Description | Phenotype | WBPhenotype:0000164 | Paper_evidence | WBPaper00043908 | |||
| Curator_confirmed | WBPerson2987 | ||||||
| WBPhenotype:0000324 | Paper_evidence | WBPaper00043908 | |||||
| Curator_confirmed | WBPerson2987 | ||||||
| WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0001391 | Paper_evidence | WBPaper00024954 | |||||
| Curator_confirmed | WBPerson8633 | ||||||
| WBPhenotype:0002287 | Paper_evidence | WBPaper00043908 | |||||
| Curator_confirmed | WBPerson2987 | ||||||
| WBPhenotype:0002289 | Paper_evidence | WBPaper00043908 | |||||
| Curator_confirmed | WBPerson2987 | ||||||
| WBPhenotype:0002292 | Paper_evidence | WBPaper00043908 | |||||
| Curator_confirmed | WBPerson2987 | ||||||
| WBPhenotype:0002295 | Paper_evidence | WBPaper00043908 | |||||
| Curator_confirmed | WBPerson2987 | ||||||
| WBPhenotype:0002301 | Paper_evidence | WBPaper00043908 | |||||
| Curator_confirmed | WBPerson2987 | ||||||
| WBPhenotype:0004022 | Paper_evidence | WBPaper00043908 | |||||
| Curator_confirmed | WBPerson2987 | ||||||
| Reference | WBPaper00043908 | ||||||
| WBPaper00033444 | |||||||
| WBPaper00024954 | |||||||
| Method | Substitution_allele |
