WormBase Tree Display for Variation: WBVar00094745
expand all nodes | collapse all nodes | view schema
WBVar00094745 | Evidence | Paper_evidence | WBPaper00026670 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | or552 | |||||
Other_name | F41H10.11.1:c.934C>T | ||||||
CE31693:p.Gln312Ter | |||||||
HGVSg | CHROMOSOME_IV:g.5368225C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F41H10 | |||
Flanking_sequences | gatcatttcgatgggctcaaggaagttcga | aacaaattgtgacgaagttggaaaataatc | |||||
Mapping_target | F41H10 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00028972 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00007458 | ||||||
Laboratory | EU | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00018321 | |||||
Transcript | F41H10.11.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F41H10.11.1:c.934C>T | ||||||
HGVSp | CE31693:p.Gln312Ter | ||||||
cDNA_position | 935 | ||||||
CDS_position | 934 | ||||||
Protein_position | 312 | ||||||
Exon_number | 5/7 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
Interactor | WBInteraction000009209 | ||||||
WBInteraction000009210 | |||||||
WBInteraction000009211 | |||||||
WBInteraction000009212 | |||||||
WBInteraction000051753 | |||||||
WBInteraction000051754 | |||||||
WBInteraction000502762 | |||||||
Genetics | Interpolated_map_position | IV | 1.59786 | ||||
Description | Phenotype (12) | ||||||
Phenotype_not_observed | WBPhenotype:0001425 | Paper_evidence | WBPaper00028972 | ||||
Curator_confirmed | WBPerson48 | ||||||
Remark | The lypophilic dye FM4-64 and VIT-2::GFP reveal accumulation in large, peripheral granules, indicating that endocytosis occurs, and that there are late defects in the endocytic pathway. | Paper_evidence | WBPaper00028972 | ||||
Curator_confirmed | WBPerson48 | ||||||
Reference | WBPaper00026670 | ||||||
WBPaper00028972 | |||||||
Method | Substitution_allele |