WormBase Tree Display for Variation: WBVar00095033
expand all nodes | collapse all nodes | view schema
WBVar00095033 | Evidence | Paper_evidence | WBPaper00006343 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | oy21 | |||||||
Other_name | CE25046:p.Gln127Ter | ||||||||
K07A9.2.1:c.379C>T | |||||||||
HGVSg | CHROMOSOME_IV:g.1832069C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | K07A9 | |||||
Flanking_sequences | acggaacaggacgcgtcgaatcttattaga | aggtgagattttcagttgaagagatcaaaa | |||||||
Mapping_target | K07A9 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031132 | ||||||||
WBStrain00047810 | |||||||||
Laboratory | PY | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000553 | |||||||
Transcript | K07A9.2.1 | VEP_consequence | stop_gained,splice_region_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | K07A9.2.1:c.379C>T | ||||||||
HGVSp | CE25046:p.Gln127Ter | ||||||||
cDNA_position | 426 | ||||||||
CDS_position | 379 | ||||||||
Protein_position | 127 | ||||||||
Exon_number | 4/9 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (22) | |||||||||
Genetics | Interpolated_map_position | IV | -15.5054 | ||||||
Description | Phenotype | WBPhenotype:0000146 | Paper_evidence | WBPaper00049050 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We also subjected AFD neurons of cmk-1 mutants to single-trial calcium imaging and found that response temperatures were abnormally perturbed at both 20 degreees Ceslius and 23 degreees Ceslius cultivation (Figures 2E and 2F; Figure S2C). While wild-type AFD neurons of 23 degreees Ceslius-cultivated animals initiated calcium responses within a temperature range of about 19.0 degreees Ceslius to 22.0 degreees Ceslius, cmk-1 mutant AFD neurons started to respond within a wider temperature range of about 16.0 degreees Ceslius to 21.0 degreees Ceslius(Figures 2E and 2F)... Similar to in vivo conditions, isolated cmk-1 mutant AFD neurons also showed increased variability in response temperature, suggesting that the lack of CMK-1 only in AFD is responsible for the abnormal variability in response temperature of AFD (Figure 2G). Indeed, expression of a cmk-1 cDNA only in AFD completely rescued the response temperatures in cmk-1 mutants, indicating that CMK-1 cell-autonomously acts in AFD (Figures 2E, 2F, and S2C)." | Paper_evidence | WBPaper00049050 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00025153 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Paper_evidence | WBPaper00049050 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | njIs24[gcy-8p::GCaMP3, gcy-8p::TagRFP] (I); Parent strain: IK1013 | Paper_evidence | WBPaper00049050 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00049050 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "While most of the wild-type animals migrated around the cultivation temperature, cmk-1 mutants dispersed over a wider range of temperatures (Figures 4A-4C). Expression of a cmk-1 cDNA only in AFD rescued this cmk-1 mutant phenotype, while the expression of a kinase-negative form (K52M) of cmk-1 cDNA failed to rescue the behavioral abnormalities (Figures 4B and 4C)." | Paper_evidence | WBPaper00049050 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00025153 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00048507 | |||||||
Curator_confirmed | WBPerson10260 | ||||||||
Remark | Figure 1C, cmk-1 mutants form dauers in the presence of live food. | Paper_evidence | WBPaper00048507 | ||||||
Curator_confirmed | WBPerson10260 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00049891 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | Quoted from paper: "These results indicate that the CMK-1 signaling pathway acts basally to repress glr-1 transcription. Expression of cmk-1 cDNA specifically in GLR-1-expressing neurons rescues the increase in Pglr-1 activity observed in cmk-1(oy21) loss-of-function mutants (Fig 3H)" | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Rescued_by_transgene | WBTransgene00026932 | ||||||||
Phenotype_assay | Strain | WBStrain00047810 | Paper_evidence | WBPaper00049891 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
Control_strain | WBStrain00047313 | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Genotype | pzIs29 [Pglr-1::NLS-GFP::LacZ::unc-54 3'UTR] | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00049050 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In the suppressor screen, we utilized pleiotropic defects of cmk-1 mutants: cmk-1 mutants showed abnormally low expression of nhr-38 promoter-fused GFP, an AFD neuron-specific GFP marker (Satterlee et al., 2004)." (Figure S3A, S3B) | Paper_evidence | WBPaper00049050 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"Furthermore, these Raf pathway mutations also suppressed the abnormally low expression of the AFD thermosensory machinery gene gcy-8 in cmk-1 mutant background (Supplemental Results; Figure S4)." As measured by RFP fluorescence, where RFP expression is driven by the gcy-8 promoter (see genotype) | Paper_evidence | WBPaper00049050 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Paper_evidence | WBPaper00049050 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | njIs2[nhr-38p::GFP, AIYp::GFP] (V); Parent strain: IK0778 | Paper_evidence | WBPaper00049050 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
njIs24[gcy-8p::GCaMP3, gcy-8p::TagRFP] (I); Parent strain: IK1013 | Paper_evidence | WBPaper00049050 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002199 | Paper_evidence | WBPaper00049050 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We subjected AFD neurons of 23 degree Celsius-cultivated cmk-1 mutants to six trials of calcium imaging and compared the variability to that of wild-type animals. While trial-to-trial variability in wild-type and cmk-1 animals were comparable, animal-to-animal variability in cmk-1 mutants was significantly larger than that of wild-type animals, showing that the lack of CMK-1 increases the animal-to-animal variability of AFD (Figure 2D)." | Paper_evidence | WBPaper00049050 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"We found that, similar to the case of AFD, the AIY neuron of cmk-1 mutants showed abnormally increased variability in response temperatures: while response temperatures of 23 degrees Celsius-cultivated wild-type AIY neurons were within a temperature range of about 16.8 degrees Celsius to 20.0 degrees Celsius, those of cmk-1 mutant AIY neurons were distributed within a wider temperature range of about 15.3 degrees Celsius to 20.1 degrees Celsius (Figure 5C). Expression of a cmk-1 cDNA only in AFD rescued these abnormal response temperatures of AIY in cmk-1 mutants, indicating that the CMK-1-mediated variability of AFD influences the variability of the AIY response (Figure 5C)." | Paper_evidence | WBPaper00049050 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00025153 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Paper_evidence | WBPaper00049050 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0005413 | PATO:0000460 | Paper_evidence | WBPaper00049050 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | njIs24[gcy-8p::GCaMP3, gcy-8p::TagRFP] (I); Parent strain: IK1013 | Paper_evidence | WBPaper00049050 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
njIs26[AIYp::GCaMP3, AIYp::TagRFP, ges-1p::nls-TagRFP] (X); Parent strain: IK1273 | Paper_evidence | WBPaper00049050 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00006343 | ||||||||
WBPaper00046106 | |||||||||
WBPaper00048507 | |||||||||
WBPaper00049050 | |||||||||
WBPaper00049891 | |||||||||
Method | Substitution_allele |