WormBase Tree Display for Variation: WBVar00143004
expand all nodes | collapse all nodes | view schema
WBVar00143004 | Evidence | Person_evidence | WBPerson261 | |||||
---|---|---|---|---|---|---|---|---|
WBPerson2629 | ||||||||
Name | Public_name | e164 | ||||||
Other_name | CE11066:p.Gln189Ter | |||||||
F54D8.1.1:c.565C>T | ||||||||
HGVSg | CHROMOSOME_III:g.5107949C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F54D8 | ||||
Flanking_sequences | gacggagaagatgctgatgatgccaaggct | agactcaacaatacgatggatgcttcactt | ||||||
Mapping_target | F54D8 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (201) | ||||||||
Laboratory | CB | |||||||
UP | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001076 | ||||||
Transcript | F54D8.1.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F54D8.1.1:c.565C>T | |||||||
HGVSp | CE11066:p.Gln189Ter | |||||||
cDNA_position | 568 | |||||||
CDS_position | 565 | |||||||
Protein_position | 189 | |||||||
Exon_number | 3/4 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000502314 | |||||||
WBInteraction000537325 | ||||||||
Genetics | Interpolated_map_position | III | -2.13511 | |||||
Mapping_data (3) | ||||||||
Description | Phenotype | WBPhenotype:0000035 | Paper_evidence | WBPaper00000031 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000572 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | low penetrance defects in outgrowth of posterior canal cell processes | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000583 | Paper_evidence (3) | |||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
WBPerson2987 | ||||||||
Remark (3) | ||||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "severe disruption with branching" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "severe disruption" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00006477 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 98.9% animals hatch (n=284). | Paper_evidence | WBPaper00006477 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000535 | Paper_evidence | WBPaper00006477 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 100% hatched animals have normal body morphology. | Paper_evidence | WBPaper00006477 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited levels of pnlp-29::GFP similar to wild-type controls under normal culture conditions. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000876 | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are no more resistant to high salt than wild-type worms. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were as susceptible to D. coniospora infection as wild type worms. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Infections with a freshly harvested solution of D. coniospora spores were done as described [65]; worms were analyzed after 24 h at 25C. Worms were pricked in the tail region using a microinjection needle under a dissecting microscope and analyzed 6 h later for GFP induction or 2 hours later for qRT-PCR. | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference (20) | ||||||||
Remark (2) | ||||||||
Method | Substitution_allele |