WormBase Tree Display for Variation: WBVar00143022
expand all nodes | collapse all nodes | view schema
WBVar00143022 | Evidence | Paper_evidence | WBPaper00027121 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | H27M09 | |||||
Flanking_sequences | acatgccaacaaggaaaggctggaccacca | gaccaccaggagatgatggaaaggacggaa | |||||||
Mapping_target | H27M09 | ||||||||
Type_of_mutation | Substitution | g | c | Paper_evidence | WBPaper00027121 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (62) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001075 | |||||||
Transcript | H27M09.4.1 (12) | ||||||||
Interactor | WBInteraction000518462 | ||||||||
Genetics (2) | |||||||||
Description | Phenotype (4) | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00001328 | ||||||||
WBPaper00000031 | |||||||||
WBPaper00004883 | |||||||||
WBPaper00024024 | |||||||||
WBPaper00014397 | |||||||||
WBPaper00016102 | |||||||||
WBPaper00025792 | |||||||||
WBPaper00033444 | |||||||||
WBPaper00061175 | |||||||||
Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||||
Method | Substitution_allele |