WormBase Tree Display for Variation: WBVar00143061

WBVar00143061 Evidence: Paper_evidence: WBPaper00004985
  Name: Public_name: e245
    Other_name (3)
    HGVSg: CHROMOSOME_IV:g.3619060C>G
  Sequence_details: SMap: S_parent: Sequence: ZC416
    Flanking_sequences: gcgattgctatggttgggttggctatggag gaatcgcgtgttttgcaatcccctatacca
    Mapping_target: ZC416
    Type_of_mutation: Substitution: g m
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (17)
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006756
      WBGene00000481
    Transcript: ZC416.8a.1 (12)
      ZC416.8b.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: ZC416.8b.1:c.1-1285G>C
        Intron_number: 1/11
    Interactor (9)
  Genetics: Interpolated_map_position: IV -3.11559
    Mapping_data: In_2_point: 103
        728
        1646
        1647
        2757
      In_multi_point (32)
  Description (2)
  Reference (22)
  Remark: Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006756 Missense 347 G to R
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000481 Intron Inferred_automatically map_Alleles.pl
  Method: Substitution_allele