WormBase Tree Display for Variation: WBVar00143061
expand all nodes | collapse all nodes | view schema
WBVar00143061 | Evidence | Paper_evidence | WBPaper00004985 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e245 | ||||||
Other_name (3) | ||||||||
HGVSg | CHROMOSOME_IV:g.3619060C>G | |||||||
Sequence_details | SMap | S_parent | Sequence | ZC416 | ||||
Flanking_sequences | gcgattgctatggttgggttggctatggag | gaatcgcgtgttttgcaatcccctatacca | ||||||
Mapping_target | ZC416 | |||||||
Type_of_mutation | Substitution | g | m | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (17) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006756 | ||||||
WBGene00000481 | ||||||||
Transcript (2) | ||||||||
Interactor | WBInteraction000518365 | |||||||
WBInteraction000518556 | ||||||||
WBInteraction000518559 | ||||||||
WBInteraction000518561 | ||||||||
WBInteraction000518851 | ||||||||
WBInteraction000518855 | ||||||||
WBInteraction000519040 | ||||||||
WBInteraction000519045 | ||||||||
WBInteraction000519046 | ||||||||
Genetics | Interpolated_map_position | IV | -3.11559 | |||||
Mapping_data | In_2_point | 103 | ||||||
728 | ||||||||
1646 | ||||||||
1647 | ||||||||
2757 | ||||||||
In_multi_point (32) | ||||||||
Description | Phenotype (14) | |||||||
Phenotype_not_observed | WBPhenotype:0000123 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | normal ChAT (choline acetyltransferase) levels | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001853 | Paper_evidence | WBPaper00035150 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutant response to AAD 1470 was comparable to that observed in wild-type | Paper_evidence | WBPaper00035150 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (22) | ||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006756 Missense 347 G to R | |||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000481 Intron Inferred_automatically map_Alleles.pl | ||||||||
Method | Substitution_allele |