WormBase Tree Display for Variation: WBVar00143148
expand all nodes | collapse all nodes | view schema
WBVar00143148 | Evidence | Person_evidence | WBPerson23830 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e362 | |||||
Other_name | CE31847:p.Gln6622Ter | ||||||
B0350.2f.1:c.19864C>T | |||||||
HGVSg | CHROMOSOME_IV:g.6002537C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | B0350 | |||
Flanking_sequences | gtctacgatgctgatacggaagaacaaaat | aacagttagaagaactggaaactgttgaag | |||||
Mapping_target | B0350 | ||||||
Type_of_mutation | Substitution | c | t | Person_evidence | WBPerson23830 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004153 | ||||||
WBStrain00006357 | |||||||
WBStrain00007116 | |||||||
WBStrain00027196 | |||||||
WBStrain00033499 | |||||||
WBStrain00033522 | |||||||
Laboratory | CB | ||||||
Person | WBPerson23830 | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006780 | |||||
Transcript | B0350.2f.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | B0350.2f.1:c.19864C>T | ||||||
HGVSp | CE31847:p.Gln6622Ter | ||||||
cDNA_position | 19864 | ||||||
CDS_position | 19864 | ||||||
Protein_position | 6622 | ||||||
Exon_number | 16/20 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
Interactor | WBInteraction000556072 | ||||||
Genetics | Interpolated_map_position | IV | 2.88918 | ||||
Mapping_data | In_2_point | 110 | |||||
825 | |||||||
In_multi_point (29) | |||||||
Description (2) | |||||||
Reference | WBPaper00040857 | ||||||
WBPaper00028448 | |||||||
WBPaper00032446 | |||||||
WBPaper00000031 | |||||||
WBPaper00006052 | |||||||
WBPaper00022718 | |||||||
WBPaper00003760 | |||||||
WBPaper00016121 | |||||||
WBPaper00045955 | |||||||
WBPaper00049389 | |||||||
Remark | alt_det = c to t mut_det = Q(6621)Ochre | ||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006780 Ochre_UAA | |||||||
Method | Substitution_allele |