WormBase Tree Display for Variation: WBVar00143154
expand all nodes | collapse all nodes | view schema
WBVar00143154 | Evidence | Paper_evidence | WBPaper00002050 | |
---|---|---|---|---|
Name (3) | ||||
Sequence_details (5) | ||||
Variation_type | Allele | |||
Origin (4) | ||||
Affects (3) | ||||
Genetics (2) | ||||
Description (2) | ||||
Reference (25) | ||||
Remark | e369 is a coupled mutation. In addition to the curated lesion there is a CAG to TAG substitution with flanking sequences agccgacgattcatgagaatgagccgttgg taatgcaaagtatcagcagacggatgttaa | Paper_evidence | WBPaper00002050 | |
Method | Substitution_allele |