WormBase Tree Display for Variation: WBVar00143233
expand all nodes | collapse all nodes | view schema
| WBVar00143233 | Evidence | Paper_evidence | WBPaper00004985 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e464 | |||||
| Other_name (3) | |||||||
| HGVSg | CHROMOSOME_IV:g.3623165C>G | ||||||
| Sequence_details | SMap | S_parent | Sequence | ZC416 | |||
| Flanking_sequences | attaactttttggatgaggagctggaattg | gatggctcttcgcttcaaaagctttgctgc | |||||
| Mapping_target | ZC416 | ||||||
| Type_of_mutation | Substitution | g | m | Paper_evidence | WBPaper00004985 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects (2) | |||||||
| Genetics (2) | |||||||
| Description | Phenotype | WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||
| Curator_confirmed | WBPerson48 | ||||||
| WBPhenotype:0001296 | Paper_evidence | WBPaper00000031 | |||||
| Curator_confirmed | WBPerson48 | ||||||
| Reference | WBPaper00000031 | ||||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006756 Missense 103 G to R Inferred_automatically map_Alleles.pl | ||||||
| Method | Substitution_allele |
