WormBase Tree Display for Variation: WBVar00143365
expand all nodes | collapse all nodes | view schema
WBVar00143365 | Evidence | Paper_evidence | WBPaper00005629 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e644 | ||||||
Other_name (20) | ||||||||
HGVSg | CHROMOSOME_V:g.4505497G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | T28F12 | ||||
Flanking_sequences | caaaggaggcgattaccaaattccgcgcgt | gttatttcacaatttgacggtaagggtgca | ||||||
Mapping_target | T28F12 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005629 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (4) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006796 | ||||||
Transcript (17) | ||||||||
Interactor | WBInteraction000007722 | |||||||
WBInteraction000051964 | ||||||||
WBInteraction000052185 | ||||||||
WBInteraction000052340 | ||||||||
WBInteraction000052341 | ||||||||
WBInteraction000501054 | ||||||||
WBInteraction000501055 | ||||||||
WBInteraction000501056 | ||||||||
Genetics | Interpolated_map_position | V | -5.18024 | |||||
Mapping_data | In_2_point | 125 | ||||||
In_multi_point | 143 | |||||||
1524 | ||||||||
3277 | ||||||||
In_pos_neg_data | 846 | |||||||
2870 | ||||||||
2871 | ||||||||
2872 | ||||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00025190 | ||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00025190 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000070 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | male tail abnormal | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000342 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | bursa small | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000583 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | slightly dumpy | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | ||||||
WBPaper00001474 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
Remark | irregular, sometimes rippling movement, especially in reverse | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Unc | Paper_evidence | WBPaper00001474 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | slightly slow | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001226 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | variable abnormalities in VD and DD commissures | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations | Anatomy_term (2) | |||||||
WBPhenotype:0001364 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | fan reduced | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001492 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 19% of embryos Nob | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | 19% | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001509 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | rays variably absent | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00001474 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | viable Unc allele | Paper_evidence | WBPaper00001474 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function (2) | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (12) | ||||||||
Method | Substitution_allele |