WormBase Tree Display for Variation: WBVar00143469
expand all nodes | collapse all nodes | view schema
WBVar00143469 | Evidence | Paper_evidence | WBPaper00006395 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e767 | |||||||
Other_name (3) | |||||||||
HGVSg | CHROMOSOME_I:g.152861C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F56C11 | |||||
Flanking_sequences | tgaatgagaatccaggtcttctctcatttg | tctgatcctcttccgttggcataactacaa | |||||||
Mapping_target | F56C11 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006395 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004204 | ||||||||
WBStrain00026835 | |||||||||
WBStrain00027251 | |||||||||
WBStrain00028999 | |||||||||
WBStrain00057323 | |||||||||
Component_of_genotype | WBGenotype00000015 | ||||||||
Laboratory | CB | ||||||||
SHU | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000253 | |||||||
Transcript (2) | |||||||||
Interactor | WBInteraction000537316 | ||||||||
Genetics | Interpolated_map_position | I | -19.1473 | ||||||
Mapping_data | In_2_point | 1 | |||||||
2504 | |||||||||
3941 | |||||||||
4741 | |||||||||
7166 | |||||||||
7167 | |||||||||
In_multi_point | 390 | ||||||||
392 | |||||||||
979 | |||||||||
1241 | |||||||||
1294 | |||||||||
2207 | |||||||||
3200 | |||||||||
In_pos_neg_data | 6276 | ||||||||
Description | Phenotype | WBPhenotype:0000025 | Paper_evidence | WBPaper00000031 | |||||
WBPaper00005747 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
Remark (2) | |||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000070 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000072 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Small irregular shape in adult. Difficult to score (ES2) in adult and late larvae. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00051549 | |||||||
Curator_confirmed | WBPerson15345 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00033445 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | When exposed to yeast infection, bli-3 mutants produced less ROS than wild-type | Paper_evidence | WBPaper00033445 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00033445 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The bli-3 mutant elicits the Dar disease earlier (after three days), in contrast to the wild type strain. Furthermore, yeast mutants that are unable to evoke the Dar response in wild type worms are competent to induce Dar in bli-3 mutant worms | Paper_evidence | WBPaper00033445 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "abnormal branched annuli (lateral hypodermis)" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00001328 | ||||||||
WBPaper00000031 | |||||||||
WBPaper00005747 | |||||||||
WBPaper00033445 | |||||||||
WBPaper00051549 | |||||||||
WBPaper00061175 | |||||||||
WBPaper00065026 | |||||||||
WBPaper00065304 | |||||||||
WBPaper00065993 | |||||||||
Remark (2) | |||||||||
Method | Substitution_allele |