WormBase Tree Display for Variation: WBVar00143471
expand all nodes | collapse all nodes | view schema
WBVar00143471 | Evidence | Person_evidence | WBPerson10095 | ||
---|---|---|---|---|---|
Name | Public_name | e769 | |||
Other_name | C09G5.2a.1:c.797+349C>T | ||||
C09G5.6.1:c.2647+1G>A | |||||
HGVSg | CHROMOSOME_II:g.10711801G>A | ||||
Sequence_details | SMap | S_parent | Sequence | C09G5 | |
Flanking_sequences | attcgagagagcatggaggacaagttccag | tagaattgttatgcggaaattatcattaaa | |||
Mapping_target | C09G5 | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin (4) | |||||
Affects | Gene | WBGene00007488 | |||
WBGene00000251 | |||||
Transcript | C09G5.2a.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | C09G5.2a.1:c.797+349C>T | ||||
Intron_number | 6/10 | ||||
C09G5.6.1 | VEP_consequence | splice_donor_variant | |||
VEP_impact | HIGH | ||||
HGVSc | C09G5.6.1:c.2647+1G>A | ||||
Intron_number | 5/6 | ||||
Interactor | WBInteraction000537315 | ||||
Genetics | Interpolated_map_position | II | 3.12418 | ||
Mapping_data | In_multi_point | 3519 | |||
In_pos_neg_data | 1219 | ||||
1222 | |||||
1248 | |||||
1289 | |||||
1344 | |||||
1405 | |||||
1421 | |||||
Description (2) | |||||
Reference | WBPaper00000031 | ||||
WBPaper00005747 | |||||
WBPaper00015964 | |||||
WBPaper00061945 | |||||
Remark | alt_det = g to a mut_det = gt -> at | Person_evidence | WBPerson10095 | ||
Curator_confirmed | WBPerson51134 | ||||
Variation information submitted by WBPerson10095 on 2022-02-17_11:55:46 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
Method | Substitution_allele |