WormBase Tree Display for Variation: WBVar00144038
expand all nodes | collapse all nodes | view schema
WBVar00144038 | Evidence | Paper_evidence | WBPaper00026986 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1489 | |||||
Other_name | T07G12.12a.1:c.775G>A | ||||||
CE36715:p.Gly259Arg | |||||||
HGVSg | CHROMOSOME_IV:g.10563247G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | T07G12 | |||
Flanking_sequences | aatcgagcaattgcgtggaagaggaaatat | gaaaacttcgtcttatcgatcacgcattgg | |||||
Mapping_target | T07G12 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00026986 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (127) | |||||||
Laboratory | CB | ||||||
NFB | |||||||
OH | |||||||
CHB | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00001867 | |||||
Transcript | T07G12.12a.1 (12) | ||||||
Genetics | Interpolated_map_position | IV | 4.63927 | ||||
Mapping_data (3) | |||||||
Description (2) | |||||||
Reference (29) | |||||||
Remark | Allele incorrectly cited as e1389 | Paper_evidence | WBPaper00003393 | ||||
Allele incorrectly cited as e2489 | Paper_evidence | WBPaper00003294 | |||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
Method | Substitution_allele |