WormBase Tree Display for Variation: WBVar00144072
expand all nodes | collapse all nodes | view schema
| WBVar00144072 | Evidence | Paper_evidence | WBPaper00002018 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e1522 | |||||
| Other_name | ZK154.3.1:c.949T>A | ||||||
| CE15257:p.Phe317Ile | |||||||
| HGVSg | CHROMOSOME_X:g.7775395A>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | ZK154 | |||
| Flanking_sequences | caacctccttcatgctcattcttcctcgga | aatggcagcagcggtgagataacgtccatg | |||||
| Mapping_target | ZK154 | ||||||
| Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003171 | |||||
| Transcript | ZK154.3.1 (11) | ||||||
| Genetics | Interpolated_map_position | X | -1.27626 | ||||
| Description | Phenotype (3) | ||||||
| Reference | WBPaper00000502 | ||||||
| WBPaper00002018 | |||||||
| WBPaper00000550 | |||||||
| Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
| [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
| Method | Substitution_allele |
