WormBase Tree Display for Variation: WBVar00144118
expand all nodes | collapse all nodes | view schema
WBVar00144118 | Evidence | Paper_evidence | WBPaper00002121 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1575 | |||||
Other_name | CE52664:p.Asn87Asp | ||||||
Y47D3A.6a.1:c.259A>G | |||||||
Y47D3A.6b.1:c.259A>G | |||||||
CE52672:p.Asn87Asp | |||||||
HGVSg | CHROMOSOME_III:g.11191851T>C | ||||||
Sequence_details | SMap | S_parent | Sequence | Y47D3A | |||
Flanking_sequences | tcagttcccccgtcacatcaaactttgagc | atcctctgcagctgagcccaccggcagaag | |||||
Mapping_target | Y47D3A | ||||||
Type_of_mutation | Substitution | a | g | Paper_evidence | WBPaper00002121 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004423 | ||||||
WBStrain00004504 | |||||||
WBStrain00004548 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006604 | |||||
WBGene00305760 | |||||||
Transcript (3) | |||||||
Interactor | WBInteraction000521253 | ||||||
Genetics | Interpolated_map_position | III | 6.94312 | ||||
Mapping_data | In_pos_neg_data | 1599 | |||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00035459 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | tra-1(e1575gf) led to only modest embryonic lethality | Paper_evidence | WBPaper00035459 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00035459 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000687 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Both XX and XO animals transformed into fertile females by e1575 or e1575/+. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Ease_of_scoring | ES3_Easy_to_score (2) | ||||||
Reference | WBPaper00016067 | ||||||
WBPaper00016560 | |||||||
WBPaper00035459 | |||||||
WBPaper00014478 | |||||||
WBPaper00016133 | |||||||
WBPaper00016592 | |||||||
Method | Substitution_allele |