WormBase Tree Display for Variation: WBVar00145123
expand all nodes | collapse all nodes | view schema
WBVar00145123 | Evidence | Paper_evidence | WBPaper00005708 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | eh10 | ||||||
Other_name | C37A2.4b.1:c.178_1201del | |||||||
CE33761:p.Gln60CysfsTer79 | ||||||||
C37A2.4a.1:c.178_1210del | ||||||||
CE24832:p.Gln60CysfsTer79 | ||||||||
HGVSg | CHROMOSOME_I:g.6781087_6783455del | |||||||
Sequence_details | SMap | S_parent | Sequence | C37A2 | ||||
Flanking_sequences | cgaaatacccgaaattcgagcgttggaagt | tgtgtaaaattctcgattttctgctatttg | ||||||
Mapping_target | C37A2 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023600 | |||||||
Laboratory | HX | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00022955 | ||||||
WBGene00000871 | ||||||||
Transcript | C37A2.4a.1 (11) | |||||||
C37A2.4b.1 (11) | ||||||||
C37A2.t1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
Interactor | WBInteraction000517294 | |||||||
Genetics | Interpolated_map_position | I | 1.31698 | |||||
Description | Phenotype | WBPhenotype:0000239 | Paper_evidence | WBPaper00035599 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Loss of the second round of vulval cell division | Paper_evidence | WBPaper00035599 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000318 | Paper_evidence | WBPaper00035599 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The time delay between the first and the second vulval division is abnormally long, so that the second (terminal) division of cye-1 (eh10) occurs at about the same time as the third (terminal) division of the wild type. | Paper_evidence | WBPaper00035599 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00038281 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Rescued by qIs134[Pcye-1::CYE-1; Psur-5::GFP]. | Paper_evidence | WBPaper00038281 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001927 | Paper_evidence | WBPaper00029347 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Penetrance | Incomplete | 36 percent showed the phenotype. | Paper_evidence | WBPaper00029347 | ||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Genotype | lag-2::GFP | Paper_evidence | WBPaper00029347 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001928 | Paper_evidence | WBPaper00029347 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Penetrance | Incomplete | 36 percent showed the phenotype. | Paper_evidence | WBPaper00029347 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00038281 | |||||||
WBPaper00005708 | ||||||||
WBPaper00029347 | ||||||||
WBPaper00035599 | ||||||||
WBPaper00044900 | ||||||||
Method | Deletion_allele |