WormBase Tree Display for Variation: WBVar00145208
expand all nodes | collapse all nodes | view schema
WBVar00145208 | Evidence | Paper_evidence | WBPaper00024331 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ep461 | |||||||
Other_name | CE08973:p.Arg460Trp | ||||||||
C54D1.6.1:c.1378C>T | |||||||||
HGVSg | CHROMOSOME_X:g.7168087G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C54D1 | |||||
Flanking_sequences | ggttttcaggaaagcctaatttgcacgcta | ggcatctctgtgttggacatccaatgtcag | |||||||
Mapping_target | C54D1 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024331 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CE | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000238 | |||||||
Transcript | C54D1.6.1 (12) | ||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | X | -1.81039 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Person_evidence | WBPerson156 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Egl/Pvl due to defects in vulval precursor cell induction. | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson156 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00024331 | |||||||
Person_evidence | WBPerson156 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2987 | |||||||||
Remark | Defects in migration of the QL progeny. | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Table 3 | Paper_evidence | WBPaper00024331 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 74 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Person_evidence | WBPerson156 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00024331 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0097402 | PATO:0000460 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | muIs35 [mec-7::GFP]; ccIs9753 [myo-2::GFP, pes-10::gfp, F22B7.9::gfp] | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000697 | Person_evidence | WBPerson156 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Egl/Pvl due to defects in vulval precursor cell induction. | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson156 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001272 | Paper_evidence | WBPaper00024331 | |||||||
Person_evidence | WBPerson156 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2987 | |||||||||
Remark | Table 3 | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 13 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Person_evidence | WBPerson156 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00024331 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0040025 | PATO:0000460 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | muIs35 [mec-7::GFP]; ccIs9753 [myo-2::GFP, pes-10::gfp, F22B7.9::gfp] | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000216 | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00024331 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0001708 | PATO:0000460 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | muIs35 [mec-7::GFP]; ccIs9753 [myo-2::GFP, pes-10::gfp, F22B7.9::gfp] | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000886 | Paper_evidence | WBPaper00024331 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors scored for animals on plate that showed Egl (egg laying defective), Pvl (protruding vulva), Bag (bag of worms), or Spew (burst through vulva) phenotypes (Table 3) | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | muIs35 [mec-7::GFP]; ccIs9753 [myo-2::GFP, pes-10::gfp, F22B7.9::gfp] | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00024331 | ||||||||
Method | Substitution_allele |