WormBase Tree Display for Variation: WBVar00145249

WBVar00145249 Evidence: Paper_evidence: WBPaper00003139
  Name: Public_name: ev557
    Other_name: CE24863:p.Tyr242Ter
      C53D6.2.1:c.726T>A
    HGVSg: CHROMOSOME_IV:g.9004061A>T
  Sequence_details: SMap: S_parent: Sequence: C53D6
    Flanking_sequences: catcattatccaatggaatcgagttataatt taatattctctcaattcttcatttcccaaat
    Mapping_target: C53D6
    Type_of_mutation: Substitution: a t Curator_confirmed: WBPerson4055
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00029123
      WBStrain00030744
    Laboratory: NW
    Status: Live
  Affects: Gene: WBGene00006852
    Transcript: C53D6.2.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C53D6.2.1:c.726T>A
        HGVSp: CE24863:p.Tyr242Ter
        cDNA_position: 751
        CDS_position: 726
        Protein_position: 242
        Exon_number: 4/7
        Codon_change: taT/taA
        Amino_acid_change: Y/*
  Genetics: Interpolated_map_position: IV 4.00146
  Description: Phenotype_not_observed: WBPhenotype:0001227 Paper_evidence: WBPaper00027335
        Curator_confirmed: WBPerson48
        Remark: Ray commissures assayed: R1, R2/3, R4/5. Paper_evidence: WBPaper00027335
            Curator_confirmed: WBPerson48
      WBPhenotype:0001645 Paper_evidence: WBPaper00040284
        Curator_confirmed: WBPerson2987
        Remark: Table S2 Paper_evidence: WBPaper00040284
            Curator_confirmed: WBPerson2987
  Reference: WBPaper00040284
    WBPaper00027335
  Remark: Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues.
    [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand Curator_confirmed: WBPerson4055
  Method: Substitution_allele