WormBase Tree Display for Variation: WBVar00145299
expand all nodes | collapse all nodes | view schema
WBVar00145299 | Evidence | Paper_evidence | WBPaper00025200 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ez25 | |||||||
Other_name | C27A2.6.1:c.1040C>A | ||||||||
CE50438:p.Ser347Ter | |||||||||
HGVSg | CHROMOSOME_II:g.5079897G>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C27A2 | |||||
Flanking_sequences | gaatgccatcaatctcgacggcttcatctt | attttcaagcatcaccggtgtgtatactt | |||||||
Mapping_target | C27A2 | ||||||||
Type_of_mutation | Substitution | c | a | Paper_evidence | WBPaper00025200 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00006443 | ||||||||
Laboratory | DZ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001102 | |||||||
Transcript | C27A2.6.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C27A2.6.1:c.1040C>A | ||||||||
HGVSp | CE50438:p.Ser347Ter | ||||||||
cDNA_position | 1057 | ||||||||
CDS_position | 1040 | ||||||||
Protein_position | 347 | ||||||||
Exon_number | 6/12 | ||||||||
Codon_change | tCa/tAa | ||||||||
Amino_acid_change | S/* | ||||||||
Interactor | WBInteraction000004834 | ||||||||
WBInteraction000502114 | |||||||||
WBInteraction000542213 | |||||||||
WBInteraction000542214 | |||||||||
WBInteraction000542215 | |||||||||
WBInteraction000542216 | |||||||||
Genetics | Interpolated_map_position | II | -2.53774 | ||||||
Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00025200 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Many dsh-2(ez25) hermaphrodites are fertile, but they produce only 5-10 embryos each. dsh-2(or302) animals are slightly less fertile than dsh-2(ez25)." | Paper_evidence | WBPaper00025200 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000691 | Paper_evidence | WBPaper00025200 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "However, at the tissue level all dsh-2 male gonads are disorganized, with somatic cells and germ line cells misplaced within the gonad (N>100) (Fig. 1E,F). To visualize this, we used the male gonadal cell marker ezIs1 (Chang et al., 2004). In wild-type males, ezIs1 is expressed in the seminal vesicle and adjacent vas deferens cells in a single region near the middle of the gonad (Fig. 1G). However, in dsh-2(ez25) male gonads ezIs1 expression is frequently observed in several clusters of cells, and these cells occur in variable locations, ranging from near the proximal tip of the gonad to near the tail." | Paper_evidence | WBPaper00025200 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006794 | PATO:0000460 | Paper_evidence | WBPaper00025200 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | ezIs1 [K09C8.2::GFP] | Paper_evidence | WBPaper00025200 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00025200 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "As expected, in wild type L1 hermaphrodites GFP::POP-1 levels were slightly higher in the proximal than in the distal Z1/Z4 daughters (Fig. 4A,B) (Siegfried et al., 2004). Reducing the dose of dsh-2 by a half (dsh-2/C) resulted in nuclear GFP::POP-1 levels that are approximately equal between proximal and distal Z1/Z4 daughters (Fig. 4C,D). Strikingly, nuclear GFP::POP-1 asymmetry was reversed in dsh-2 homozygotes, and was detectable only in the distal Z1/Z4 daughters (Fig. 4E,F)." | Paper_evidence | WBPaper00025200 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004577 | PATO:0000460 | Paper_evidence | WBPaper00025200 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004574 | PATO:0000460 | Paper_evidence | WBPaper00025200 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | sys-1p::GFP::POP-1 | Paper_evidence | WBPaper00025200 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001357 | Paper_evidence | WBPaper00025200 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Most dsh-2 males have J-shaped gonads similar to those of wild type males (73%, N=100)." | Paper_evidence | WBPaper00025200 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 27 | Paper_evidence | WBPaper00025200 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006794 | PATO:0000460 | Paper_evidence | WBPaper00025200 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001586 | Paper_evidence | WBPaper00025200 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Wild type hermaphrodites have a single AC (Kimble and Hirsh, 1979), and express cdh-3:gfp at high levels in one gonadal cell at the early L3 stage (Fig. 2A). By contrast, dsh-2(ez25) hermaphrodites contain a variable number of cdh-3::gfp expressing gonadal cells, with 60% possessing one, 38% possessing two, and 2% possessing three (NZ52) (Fig. 2B)." | Paper_evidence | WBPaper00025200 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 40 | Paper_evidence | WBPaper00025200 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004522 | PATO:0000460 | Paper_evidence | WBPaper00025200 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | cdh-3:gfp | Paper_evidence | WBPaper00025200 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001962 | Paper_evidence | WBPaper00025200 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In wild-type hermaphrodites lag-2::gfp is expressed in DTCs at both ends of the growing gonadal arm (Fig. 2C). By contrast, most dsh-2(ez25) hermaphrodites lack one (54%) or both (28%) of the DTCs (N=50; Fig. 2D). The frequency of missing DTCs in dsh-2(ez25) closely correlates with the frequency of missing gonadal arms, and thus is likely to contribute to that defect." | Paper_evidence | WBPaper00025200 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006863 | PATO:0000460 | Paper_evidence | WBPaper00025200 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | lag-2::gfp | Paper_evidence | WBPaper00025200 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002189 | Paper_evidence | WBPaper00025200 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To assess whether dsh-2 males also have PD axis defects, we therefore assayed the number of LCs. The LC in wild type males is evident as a large round cell at the growing end of the gonad and strongly expresses lag-2::gfp (Fig. 2E). Most dsh-2 males have a single LC that guides the growing gonadal arm and is engulfed when it makes a connection with the cloaca, as in wild-type (86% N=49). However, we also observed animals with two LCs (14% N=49, Fig. 2F). In these animals, one LC does not get engulfed and persists into the late L4 and adult stages (Fig. 2F)." | Paper_evidence | WBPaper00025200 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 14 | Paper_evidence | WBPaper00025200 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005062 | PATO:0000460 | Paper_evidence | WBPaper00025200 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | lag-2::GFP | Paper_evidence | WBPaper00025200 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002207 | Paper_evidence | WBPaper00025200 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "ez25 hermaphrodites frequently lack one or both gonad arms, while males form a J-shaped gonad with grossly normal morphology... 34% of dsh-2(ez25) and 43% of dsh-2(or302) hermaphrodites are missing both gonadal arms and 46% of dsh-2(ez25) and 43% of dsh-2(or302) mutants lack one gonadal arm (Fig. 1B,C, Table 1)." "The stop codon introduced by the dsh-2(ez25) mutation immediately precedes the PDZ domain, a critical domain in other dishevelled proteins, suggesting that ez25 may be a strong loss-of-function mutation or null allele... The slightly weaker phenotype of ez25 relative to or302 suggests that ez25 may retain some DSH-2 function." | Paper_evidence | WBPaper00025200 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 80 | Paper_evidence | WBPaper00025200 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00025200 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005178 | PATO:0000460 | Paper_evidence | WBPaper00025200 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00025200 | ||||||||
Method | Substitution_allele |