WormBase Tree Display for Variation: WBVar00145317
expand all nodes | collapse all nodes | view schema
WBVar00145317 | Evidence | Person_evidence | WBPerson431 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | fc21 | |||||
Other_name | CE11980:p.Arg290Lys | ||||||
K09A9.5.1:c.869G>A | |||||||
HGVSg | CHROMOSOME_X:g.15589151C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | K09A9 | |||
Flanking_sequences | tgctcaccgaaaaccgaatctggaaggcca | aactattgacatcggacttgtgtcagctgc | |||||
Mapping_target | K09A9 | ||||||
Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson431 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00005211 | ||||||
Laboratory | CW | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001520 | |||||
Transcript | K09A9.5.1 (12) | ||||||
Interactor (17) | |||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | X | 22.8778 | ||||
Description | Phenotype (16) | ||||||
Phenotype_not_observed | WBPhenotype:0001991 | Paper_evidence | WBPaper00034694 | ||||
Curator_confirmed | WBPerson2857 | ||||||
Remark | animals enter into hypoxia-induced reproductive and developmental diapause same as wild-type | Paper_evidence | WBPaper00034694 | ||||
Curator_confirmed | WBPerson2857 | ||||||
Disease_info | Models_disease | DOID:1574 | |||||
DOID:0060536 | |||||||
Models_disease_in_annotation | WBDOannot00000655 | ||||||
WBDOannot00001068 | |||||||
WBDOannot00001069 | |||||||
WBDOannot00001070 | |||||||
WBDOannot00001071 | |||||||
Reference | WBPaper00022432 | ||||||
WBPaper00040161 | |||||||
WBPaper00002358 | |||||||
WBPaper00002037 | |||||||
WBPaper00034694 | |||||||
WBPaper00023301 | |||||||
WBPaper00042217 | |||||||
WBPaper00061172 | |||||||
Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Method | Substitution_allele |