WormBase Tree Display for Variation: WBVar00145346
expand all nodes | collapse all nodes | view schema
| WBVar00145346 | Evidence | Paper_evidence | WBPaper00032966 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ft7 | |||||
| Other_name | CE45435:p.Trp165Ter | ||||||
| CE43301:p.Trp165Ter | |||||||
| F29C12.3a.1:c.494delinsA | |||||||
| F29C12.3b.1:c.494delinsA | |||||||
| HGVSg | CHROMOSOME_II:g.13116193delinsT | ||||||
| Sequence_details | SMap | S_parent | Sequence | F29C12 | |||
| Flanking_sequences | gaacgattggaagctttcaagttaattattt | atgcttaaaatctacgagaaatccaatctc | |||||
| Mapping_target | F29C12 | ||||||
| Type_of_mutation | Substitution | gg | rr | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00023655 | ||||||
| Laboratory | KQ | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00009245 | |||||
| Transcript | F29C12.3b.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F29C12.3b.1:c.494delinsA | ||||||
| HGVSp | CE45435:p.Trp165Ter | ||||||
| cDNA_position | 499-500 | ||||||
| CDS_position | 494-495 | ||||||
| Protein_position | 165 | ||||||
| Exon_number | 4/18 | ||||||
| Codon_change | tGG/tAG | ||||||
| Amino_acid_change | W/* | ||||||
| F29C12.3a.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | F29C12.3a.1:c.494delinsA | ||||||
| HGVSp | CE43301:p.Trp165Ter | ||||||
| cDNA_position | 503-504 | ||||||
| CDS_position | 494-495 | ||||||
| Protein_position | 165 | ||||||
| Exon_number | 4/18 | ||||||
| Codon_change | tGG/tAG | ||||||
| Amino_acid_change | W/* | ||||||
| Interactor | WBInteraction000537341 | ||||||
| WBInteraction000537342 | |||||||
| WBInteraction000537363 | |||||||
| WBInteraction000537364 | |||||||
| WBInteraction000537365 | |||||||
| WBInteraction000537367 | |||||||
| WBInteraction000537369 | |||||||
| Isolation | Mutagen | EMS | |||||
| Genetics | Interpolated_map_position | II | 14.4354 | ||||
| Description | Phenotype (17) | ||||||
| Phenotype_not_observed | WBPhenotype:0001574 | Paper_evidence | WBPaper00045812 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Remark | "sgk-1(ok538) and rict-1(ft7) loss of function animals did not show a significant change in the total amount of ATP when compared to wild type control at the young adult stage (data not shown). Since alterations in ATP levels are not easily detectable at the young adult stage we also looked at day 10 of adulthood; in agreement, we did not observe any alteration in the ATP content of the mutant animals (Figure S7)." | Paper_evidence | WBPaper00045812 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| WBPhenotype:0001893 | Paper_evidence | WBPaper00045812 | |||||
| Curator_confirmed | WBPerson2987 | ||||||
| Remark | "In accord with previously published work [61], we observed that the mitochondrial membrane potential is reduced in daf-2(e1370) mutant animals. However we did not observe any statistical differences in the sgk-1(ok538) and rict-1(ft7) loss of function animals compared to the wild type control (Figure S7)." | Paper_evidence | WBPaper00045812 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Reference | WBPaper00032966 | ||||||
| WBPaper00045812 | |||||||
| WBPaper00051289 | |||||||
| WBPaper00053668 | |||||||
| WBPaper00058809 | |||||||
| WBPaper00064979 | |||||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00009245 Amber_UAG_or_Opal_UGA W to STOP | Paper_evidence | WBPaper00032966 | ||||
| Method | Substitution_allele |
