WormBase Tree Display for Variation: WBVar00145349
expand all nodes | collapse all nodes | view schema
| WBVar00145349 | Evidence | Paper_evidence | WBPaper00033465 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | fw5 | ||||||
| Other_name | R06C7.8.1:c.2333A>G | |||||||
| CE06251:p.Glu778Gly | ||||||||
| HGVSg | CHROMOSOME_I:g.7254456A>G | |||||||
| Sequence_details | SMap | S_parent | Sequence | R06C7 | ||||
| Flanking_sequences | atcagtaccacgaatatggaacgctgcttg | atatgcgaataacatgaaggatccgaattgg | ||||||
| Mapping_target | R06C7 | |||||||
| Type_of_mutation | Substitution | a | g | Paper_evidence | WBPaper00033465 | |||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Laboratory | PU | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00000275 | ||||||
| Transcript | R06C7.8.1 (12) | |||||||
| Genetics | Interpolated_map_position | I | 1.86256 | |||||
| Description | Phenotype | WBPhenotype:0000059 | Paper_evidence | WBPaper00033465 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| WBPhenotype:0000180 | Paper_evidence | WBPaper00033465 | ||||||
| Curator_confirmed | WBPerson557 | |||||||
| Remark | Authors note longitudinal extension defects in axons that were scored as regions that lack GFP-labeled axons. | Paper_evidence | WBPaper00033465 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Phenotype_assay | Genotype | Punc-25::GFP | Paper_evidence | WBPaper00033465 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| WBPhenotype:0000384 | Paper_evidence | WBPaper00033465 | ||||||
| Curator_confirmed | WBPerson557 | |||||||
| Remark | Axon guidance defects include premature stop or inappropriate branching of axons. | Paper_evidence | WBPaper00033465 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Phenotype_assay | Genotype | Punc-25::GFP | Paper_evidence | WBPaper00033465 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| WBPhenotype:0000679 | Paper_evidence | WBPaper00033465 | ||||||
| Curator_confirmed | WBPerson557 | |||||||
| Remark | Authors note longitudinal extension defects in axons that were scored as regions that lack GFP-labeled axons. | Paper_evidence | WBPaper00033465 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Phenotype_assay | Genotype | Punc-25::GFP | Paper_evidence | WBPaper00033465 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| WBPhenotype:0000688 | Paper_evidence | WBPaper00033465 | ||||||
| Curator_confirmed | WBPerson557 | |||||||
| WBPhenotype:0000697 | Paper_evidence | WBPaper00033465 | ||||||
| Curator_confirmed | WBPerson557 | |||||||
| Penetrance | Low | Paper_evidence | WBPaper00033465 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| WBPhenotype:0000698 | Paper_evidence | WBPaper00033465 | ||||||
| Curator_confirmed | WBPerson557 | |||||||
| WBPhenotype:0001226 | Paper_evidence | WBPaper00033465 | ||||||
| Curator_confirmed | WBPerson557 | |||||||
| Remark | Commissure defect refers to the D-type neuron commissures that extend from left side of the animals. | Paper_evidence | WBPaper00033465 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Phenotype_assay | Genotype | Punc-25::GFP | Paper_evidence | WBPaper00033465 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| Reference | WBPaper00033465 | |||||||
| Remark | fw5 has two substitutions:E778G and W726 Stop. | |||||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000275 Amber_UAG_or_Opal_UGA | ||||||||
| Method | Substitution_allele |
