WormBase Tree Display for Variation: WBVar00145424

WBVar00145424 Evidence: Paper_evidence: WBPaper00003177
  Name: Public_name: ga111
    Other_name: CE01583:p.Val148Gly
      F43C1.2b.1:c.647T>G
      CE24971:p.Val216Gly
      F43C1.2a.2:c.443T>G
      F43C1.2a.1:c.443T>G
    HGVSg: CHROMOSOME_III:g.4218549A>C
  Sequence_details: SMap: S_parent: Sequence: F43C1
    Flanking_sequences: cgtggtctcaaatacattcactctgcaaatg gctccatcgtgatttgaaaccatcgaatttg
    Mapping_target: F43C1
    Type_of_mutation: Substitution: t g Paper_evidence: WBPaper00003177
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033914
    Laboratory: SD
    Status: Live
  Affects: Gene: WBGene00003401
    Transcript: F43C1.2a.2 (12)
      F43C1.2b.1 (12)
      F43C1.2a.1 (12)
    Interactor: WBInteraction000500571
      WBInteraction000500573
      WBInteraction000501191
      WBInteraction000502697
      WBInteraction000502698
      WBInteraction000505071
  Genetics: Interpolated_map_position: III -3.6598
  Description: Phenotype: WBPhenotype:0000436 Paper_evidence: WBPaper00032296
        Curator_confirmed: WBPerson712
        Remark: ZHP-3 remains localized along the SC in late pachytene in mpk-1 mutants. Paper_evidence: WBPaper00032296
            Curator_confirmed: WBPerson712
      WBPhenotype:0000463 Paper_evidence: WBPaper00031318
        Curator_confirmed: WBPerson712
        Remark: The levels of the diphosphorylated activated form of MPK-1 (dpMPK-1) are very low in the gonad distal to the loop while variably patchy accumulation is observed in the proximal gonad. Paper_evidence: WBPaper00031318
            Curator_confirmed: WBPerson712
        Variation_effect: Loss_of_function_undetermined_extent: Paper_evidence: WBPaper00031318
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00031318
              Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Paper_evidence: WBPaper00031914
        Curator_confirmed: WBPerson712
        Remark: 100% animals were sterile. Paper_evidence: WBPaper00031914
            Curator_confirmed: WBPerson712
        Penetrance: Complete: Paper_evidence: WBPaper00031914
              Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: 25 Paper_evidence: WBPaper00031914
              Curator_confirmed: WBPerson712
      WBPhenotype:0001121 Paper_evidence: WBPaper00035176
        Curator_confirmed: WBPerson2021
        Remark: mpk-1(ga111) mutants behaved more asynchronous than wild type with division timings of 7:48 min (AB) and 10:48 min (P1) Paper_evidence: WBPaper00035176
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001645 Paper_evidence: WBPaper00041737
        Curator_confirmed: WBPerson10418
        Remark: mpk-1(ga111) causes increased LIN-45 protein stability. Paper_evidence: WBPaper00041737
            Curator_confirmed: WBPerson10418
      WBPhenotype:0001797 Paper_evidence: WBPaper00031318
        Curator_confirmed: WBPerson712
        Remark: There is a strong but incompletely penetrant pachytene-arrest phenotype at the restrictive temperature. Paper_evidence: WBPaper00031318
            Curator_confirmed: WBPerson712
        Variation_effect: Loss_of_function_undetermined_extent: Paper_evidence: WBPaper00031318
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00031318
              Curator_confirmed: WBPerson712
      WBPhenotype:0001925 Paper_evidence: WBPaper00031318
        Curator_confirmed: WBPerson712
        Remark: -1 through -3 oocytes were significantly larger than wild type. The nucleus of proximal oocytes, which in wild type migrates to the distal edge, is centrally located and fails to migrate. Paper_evidence: WBPaper00031318
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031318
            Curator_confirmed: WBPerson712
      WBPhenotype:0001951 Paper_evidence: WBPaper00031318
        Curator_confirmed: WBPerson712
        Remark: Under conditions of partial mpk-1 lf, i.e., shift-up of ga111 to 25 deg C, disruptions of pachytene germ cell organization are less severe than in the null, including gaps in the honeycomb pattern and the presence of internal nuclei in the rachis. Paper_evidence: WBPaper00031318
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031318
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000034 Paper_evidence: WBPaper00035176
        Curator_confirmed: WBPerson2021
        Remark: MEX-5 distribution in mpk-1(ga111) mutants did not differ significantly from wild-type animals Paper_evidence: WBPaper00035176
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000436 Paper_evidence: WBPaper00035176
        Curator_confirmed: WBPerson2021
        Remark: In mpk-1(ga111) mutant embryos, the domain size of PAR-1 or PAR-3 did not significantly differ from wild-type Paper_evidence: WBPaper00035176
            Curator_confirmed: WBPerson2021
  Reference (11)
  Remark: Paper states that the ga111 mutant has a T to C transition giving rise to a Val148Gly change. This is contradictory as a T to C would give rise to a Val148Ala change. The transition has been changed to a T to G Paper_evidence: WBPaper00003177
      Curator_confirmed: WBPerson2970
  Method: Substitution_allele