WormBase Tree Display for Variation: WBVar00145453
expand all nodes | collapse all nodes | view schema
| WBVar00145453 | Evidence | Paper_evidence | WBPaper00035199 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | gg100 | |||||
| Other_name | CE50813:p.Arg122Ter | ||||||
| CE30106:p.Arg810Ter | |||||||
| R09A1.1b.1:c.1207C>T | |||||||
| CE50770:p.Arg403Ter | |||||||
| R09A1.1c.1:c.364C>T | |||||||
| R09A1.1a.1:c.2428C>T | |||||||
| HGVSg | CHROMOSOME_V:g.1016395C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | R09A1 | |||
| Flanking_sequences | tcagccttcaccaaagaattgcgccctaacc | gattgatggtggaaaaagtgctcggaaaagt | |||||
| Mapping_target | R09A1 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00035199 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00040759 | ||||||
| Laboratory | YY | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00019971 | |||||
| Transcript | R09A1.1b.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | R09A1.1b.1:c.1207C>T | ||||||
| HGVSp | CE50770:p.Arg403Ter | ||||||
| cDNA_position | 1207 | ||||||
| CDS_position | 1207 | ||||||
| Protein_position | 403 | ||||||
| Exon_number | 4/5 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| R09A1.1c.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | R09A1.1c.1:c.364C>T | ||||||
| HGVSp | CE50813:p.Arg122Ter | ||||||
| cDNA_position | 364 | ||||||
| CDS_position | 364 | ||||||
| Protein_position | 122 | ||||||
| Exon_number | 3/4 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| R09A1.1a.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | R09A1.1a.1:c.2428C>T | ||||||
| HGVSp | CE30106:p.Arg810Ter | ||||||
| cDNA_position | 2438 | ||||||
| CDS_position | 2428 | ||||||
| Protein_position | 810 | ||||||
| Exon_number | 7/9 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| Genetics | Interpolated_map_position | V | -19.871 | ||||
| Description | Phenotype | WBPhenotype:0001258 | Paper_evidence | WBPaper00035199 | |||
| WBPaper00038150 | |||||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Tissue and RNA-specific enhancement. Exhibits an Eri phenotype that has an upper bound of 95% confidence interval at least 100% penetrant with a ~10% standard deviation in muscle (act-3), neuron, pharynx (pha-4), and ubiquitous (knl-3, vha-15). | Paper_evidence | WBPaper00038150 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Phenotype_not_observed | WBPhenotype:0000688 | Paper_evidence | WBPaper00038150 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00038150 | ||||||
| WBPaper00035199 | |||||||
| Remark | This mutation is 'R810 to stop', not the stated 'R809 to Stop'. | Person_evidence | WBPerson315 | ||||
| Method | Substitution_allele |
