WormBase Tree Display for Variation: WBVar00145482
expand all nodes | collapse all nodes | view schema
WBVar00145482 | Name (3) | ||||||||
---|---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | C04F6 | |||||
Flanking_sequences | gttgtataacacaatggttccatctcctcc | cggaatagtagttttcagaatgtgggtggt | |||||||
Mapping_target | C04F6 | ||||||||
Type_of_mutation | Insertion | tgtgttcggaa | |||||||
Deletion | |||||||||
PCR_product | GK27_external | ||||||||
GK27_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035493 | ||||||||
Laboratory | VC | ||||||||
Person | WBPerson427 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006810 | |||||||
Transcript | C04F6.4a.1 (11) | ||||||||
Interactor | WBInteraction000501690 | ||||||||
WBInteraction000502344 | |||||||||
WBInteraction000542289 | |||||||||
WBInteraction000542290 | |||||||||
WBInteraction000542291 | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000436 | Paper_evidence | WBPaper00032338 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | TMD-1 mislocalized to actin aggregates in body wall muscles based on immunolocalization of TMD-1 and UNC-60B. | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001206 | Paper_evidence | WBPaper00032338 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited a lower frequency of head movements in liquid compared to wild-type animals. | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Adult worms were placed in M9 buffer. Then, one beat was counted when a worm swung its head to either the right or left. The total number of beats in 30 seconds was recorded. Worm motility was quantified as described previously (Epstein and Thomson, 1974). Animals were treated with control dsRNA. | Paper_evidence | WBPaper00032338 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001587 | Paper_evidence | WBPaper00032338 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | F-actin aggregated in body wall muscle. | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00032338 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Adult worms treated with control dsRNA were stained with tetramethyl-Rhodamine-phalloidin, and worms with actin aggregates in their muscle were scored. | Paper_evidence | WBPaper00032338 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00032446 | ||||||||
WBPaper00032338 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |