WormBase Tree Display for Variation: WBVar00145483
expand all nodes | collapse all nodes | view schema
WBVar00145483 | Name | Public_name | gk28 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.9793653_9795633del | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_I | ||||
Flanking_sequences | attgcgatatacataatttcaaaaaaaaaa | atcgggatccgctcagtctacaatcgaaaa | ||||||
Mapping_target | CHROMOSOME_I | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | GK28_external | |||||||
GK28_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035494 | |||||||
Laboratory | VC | |||||||
Person | WBPerson427 | |||||||
WBPerson2838 | ||||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00009164 | ||||||
Transcript | F26E4.11.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-1418 | |||||||
CDS_position | ?-1418 | |||||||
Protein_position | ?-473 | |||||||
Intron_number | 1-4/6 | |||||||
Exon_number | 1-5/7 | |||||||
Interactor | WBInteraction000520511 | |||||||
Description | Phenotype_not_observed | WBPhenotype:0000523 | Paper_evidence | WBPaper00030999 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | hrd-1(gk28) animals exhibited a wild type growth rate in the presence of 5 mM DTT | Paper_evidence | WBPaper00030999 | |||||
Curator_confirmed | WBPerson2987 | |||||||
hrd-1(gk28) animals exhibited a wild type growth rate in the presence of 5 μM thapsigargin | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004908 | Paper_evidence | WBPaper00030999 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBMol:00002963 | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Eggs were laid on plates containing 5 millimolar DTT for 2 hours and analyzed after 72 hours | Paper_evidence | WBPaper00030999 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Eggs were laid on plates containing 5 micromolar thapsigargin for 2 hours and analyzed after 72 hours | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000676 | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | hrdl-1(gk28) deletion did not affect the growth rate (Fig. 3A). | Paper_evidence | WBPaper00030999 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Interestingly, hrd-1 RNAi treatment induced the hsp-4::gfp expression in an ire-1-dependent manner, while hrdl-1(gk28) and marc-6(RNAi) did not induce it (Fig. 4A)." | Paper_evidence | WBPaper00030999 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001506 | Paper_evidence | WBPaper00060631 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals lacking full-length hrdl-1 reversed less than wild-type animals, but this was not statistically significant (Figure 1A). | Paper_evidence | WBPaper00060631 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00030999 | |||||||
WBPaper00060631 | ||||||||
Remark | Last updated on 29 Nov 2002 | |||||||
Generated by the C. elegans Gene Knockout Consortium | ||||||||
Allele sequenced by Yohei Sasagawa | Curator_confirmed | WBPerson2970 | ||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |