WormBase Tree Display for Variation: WBVar00145532
expand all nodes | collapse all nodes | view schema
WBVar00145532 | Name | Public_name | gk125 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_V:g.14017788_14018827del | |||||||
Sequence_details | SMap | S_parent | Sequence | T08G5 | ||||
Flanking_sequences | catatgagatcaaaagttagtaaatacttt | tttggatttttgaaaataaaatttgataga | ||||||
Mapping_target | T08G5 | |||||||
Type_of_mutation | Insertion | a | ||||||
Deletion | ||||||||
PCR_product | GK125_external | |||||||
GK125_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035525 | |||||||
WBStrain00040877 | ||||||||
Laboratory | VC | |||||||
Person | WBPerson427 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003474 | ||||||
WBGene00011622 | ||||||||
Transcript | T08G5.10.1 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2/3 | |||||||
Exon_number | 1-4/4 | |||||||
T08G5.1.1 | VEP_consequence | 5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-62 | |||||||
Exon_number | 1/7 | |||||||
Interactor | WBInteraction000524545 | |||||||
WBInteraction000524569 | ||||||||
WBInteraction000524570 | ||||||||
Genetics | Mapping_data | In_multi_point | 4500 | |||||
Description | Phenotype | WBPhenotype:0000043 | Paper_evidence | WBPaper00024351 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | mtl-2(gk125) mutant animals showed a modest but significant increase in 'egg-to-egg' generation time compared to wild type animals (Table 1). | Paper_evidence | WBPaper00024351 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00034661 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The mtl-2(gk125) mutation resulted in reduced induction of mRNA expression of the genes M162.5 and sod-3 in response to silver nanoparticle (AgNP) exposure, compared to wild type animals and as determined by qRT-PCR (Figure 4 compared to Figure 3A). | Paper_evidence | WBPaper00034661 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00005288 | Paper_evidence | WBPaper00034661 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00028866 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure 2 | Paper_evidence | WBPaper00028866 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000357 | Paper_evidence | WBPaper00041036 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | A high number and an earlier onset of unfertilized embryos (oocytes) were observed in mtl-2(gk125) mutants compared with wild type (data not shown). | Paper_evidence | WBPaper00041036 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null (2) | |||||||
WBPhenotype:0000591 | Paper_evidence | WBPaper00034661 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | mtl-2(gk125) mutants exhibited a significant resistance to the toxic effects of silver nanoparticles on reproduction (Table 1) | Paper_evidence | WBPaper00034661 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00005288 | Paper_evidence | WBPaper00034661 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001655 | Paper_evidence | WBPaper00024351 | ||||||
WBPaper00041036 | ||||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | mtl-2(gk125) mutant animals showed a modest decrease in life span in the presence of 30 μM cadmium compared to wild type animals (Figure 6) | Paper_evidence | WBPaper00024351 | |||||
Curator_confirmed | WBPerson2987 | |||||||
mtl-2(gk125) mutants exhibited a significantly reduced growth rate in the presence of 100 μM cadmium, compared to wild type (Figure 5) | Paper_evidence | WBPaper00041036 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00041036 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002125 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Exposure to selected coated silver nanoparticles (Ag NPs), PVP8, PVP38, CIT7, GA5 and GA22 resulted in an enhanced level of growth inhibition compared to N2 animals exposed to the same nanoparticles and silver nitrate. | Paper_evidence | WBPaper00040519 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00005288 | Paper_evidence | WBPaper00040519 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBMol:00005290 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBMol:00005293 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBMol:00005294 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBMol:00005295 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBMol:00005296 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBMol:00003522 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002230 | Paper_evidence | WBPaper00036389 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | In the presence of 25 μM cadmium, mtl-2(gk125) mutants exhibited increased accumulation of cadmium, compared to wild type controls (Figure 4A, Table S1), as determined by inductively coupled plasma optical emission spectrometry (ICP-OES) | Paper_evidence | WBPaper00036389 | |||||
Curator_confirmed | WBPerson2987 | |||||||
In the presence of 340 μM zinc, mtl-2(gk125) mutants exhibited substantially increased accumulation of zinc, compared to wild type controls (Figure 4B, Table S1), as determined by inductively coupled plasma optical emission spectrometry (ICP-OES) | Paper_evidence | WBPaper00036389 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00036389 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBMol:00005064 | Paper_evidence | WBPaper00036389 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Animals were exposed to 25 micromolar cadmium | Paper_evidence | WBPaper00036389 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Animals were exposed to 340 micromolar zinc | Paper_evidence | WBPaper00036389 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002251 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Exposure to selected coated silver nanoparticles (Ag NPs), PVP8, PVP38, CIT7, GA5 and GA22 resulted in an enhanced level of growth inhibition compared to N2 animals exposed to the same nanoparticles and silver nitrate. | Paper_evidence | WBPaper00040519 | |||||
Curator_confirmed | WBPerson557 | |||||||
Affected_by | Molecule | WBMol:00005288 | Paper_evidence | WBPaper00040519 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBMol:00005290 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson557 | |||||||
WBMol:00005293 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson557 | |||||||
WBMol:00005294 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson557 | |||||||
WBMol:00005295 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson557 | |||||||
WBMol:00005296 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson557 | |||||||
WBMol:00003522 | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00028866 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure 4 | Paper_evidence | WBPaper00028866 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00041036 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Supplementary Table 2 | Paper_evidence | WBPaper00041036 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00041036 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Supplementary Table 2 | Paper_evidence | WBPaper00041036 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00041036 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00041036 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | data not shown | Paper_evidence | WBPaper00041036 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001379 | Paper_evidence | WBPaper00044243 | ||||||
Curator_confirmed | WBPerson3701 | |||||||
Remark | not more sensitive than wildtype to toxicity from exposure to pore water from sediments downstream of mountaintop mining sites (Figure S2) | Paper_evidence | WBPaper00044243 | |||||
Curator_confirmed | WBPerson3701 | |||||||
WBPhenotype:0001653 | Paper_evidence | WBPaper00028866 | ||||||
WBPaper00033210 | ||||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure 2, Figure 4 | Paper_evidence | WBPaper00028866 | |||||
Curator_confirmed | WBPerson2987 | |||||||
mtl-2(gk125) mutants exhibited a normal decrease in cystathionine levels and increase in phytochelatin levels in response to cadmium exposure, compared to wild type controls (Figure 2, 4) | Paper_evidence | WBPaper00033210 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00033210 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00040519 | |||||||
WBPaper00041036 | ||||||||
WBPaper00034661 | ||||||||
WBPaper00033444 | ||||||||
WBPaper00024351 | ||||||||
WBPaper00028866 | ||||||||
WBPaper00033210 | ||||||||
WBPaper00036389 | ||||||||
WBPaper00044243 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |