WormBase Tree Display for Variation: WBVar00145564
expand all nodes | collapse all nodes | view schema
WBVar00145564 | Evidence | Paper_evidence | WBPaper00038487 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | gk157 | |||||
HGVSg | |||||||
Sequence_details | SMap | S_parent | Sequence | C27H5 | |||
Flanking_sequences | actatttatgtagattttctgaagaaaatt | tgttattgcacgcaatggatgaataatatt | |||||
Mapping_target | C27H5 | ||||||
Type_of_mutation | Insertion | CGCTGATTTTTGACTTTTTCNGNTCATTTCGGGGAANGAT | |||||
Deletion | |||||||
PCR_product | gk157_external | ||||||
gk157_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00035644 | ||||||
Laboratory | VC | ||||||
Person | WBPerson427 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00044938 | |||||
WBGene00003966 | |||||||
WBGene00045090 | |||||||
Transcript | C27H5.10 | VEP_consequence | non_coding_transcript_exon_variant | ||||
VEP_impact | MODIFIER | ||||||
cDNA_position | 63-? | ||||||
Exon_number | 1/1 | ||||||
C27H5.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
Intron_number | 2-3/5 | ||||||
Exon_number | 1-3/6 | ||||||
C27H5.9 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | ||||||
Exon_number | 1/1 | ||||||
Isolation | Mutagen | UV/TMP | |||||
Genetics | Mapping_data | In_multi_point | 4568 | ||||
Description | Phenotype (17) | ||||||
Phenotype_not_observed | WBPhenotype:0002469 | Paper_evidence | WBPaper00038487 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The probability and size of response to plate taps decreased with continued taps applied with a 10s interval, similar to the response of N2 animals. | Paper_evidence | WBPaper00038487 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00038487 | ||||||
WBPaper00043908 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |