WormBase Tree Display for Variation: WBVar00145576
expand all nodes | collapse all nodes | view schema
WBVar00145576 | Evidence | Paper_evidence | WBPaper00032399 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | gk169 | ||||||
Other_name | F09E5.15c.1:c.18+195_216del | |||||||
F09E5.15b.1:c.13-207_210del | ||||||||
HGVSg | CHROMOSOME_II:g.5378635_5379039del | |||||||
Sequence_details | SMap | S_parent | Sequence | F09E5 | ||||
Flanking_sequences | ctcatttcgtcctccgattttttttctttc | aacaccgttgtgctcgccgcttccaccgac | ||||||
Mapping_target | F09E5 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | gk169_external | |||||||
gk169_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035650 | |||||||
Laboratory | VC | |||||||
Person | WBPerson427 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006434 | ||||||
Transcript | F09E5.15b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F09E5.15b.1:c.13-207_210del | |||||||
cDNA_position | ?-210 | |||||||
CDS_position | ?-210 | |||||||
Protein_position | ?-70 | |||||||
Intron_number | 1/2 | |||||||
Exon_number | 2/3 | |||||||
F09E5.15a.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-198 | |||||||
CDS_position | ?-198 | |||||||
Protein_position | ?-66 | |||||||
Exon_number | 1/3 | |||||||
F09E5.15c.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F09E5.15c.1:c.18+195_216del | |||||||
cDNA_position | ?-216 | |||||||
CDS_position | ?-216 | |||||||
Protein_position | ?-72 | |||||||
Intron_number | 1/2 | |||||||
Exon_number | 2/3 | |||||||
Interactor | WBInteraction000503847 | |||||||
WBInteraction000520387 | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0000119 | Paper_evidence | WBPaper00046711 | ||||
Curator_confirmed | WBPerson3979 | |||||||
Remark | prdx-2 (gk169) contains increased nuclear levels of SKN-1 and DAF-16 transcription factors. | Paper_evidence | WBPaper00046711 | |||||
Curator_confirmed | WBPerson3979 | |||||||
WBPhenotype:0000135 | Paper_evidence | WBPaper00032399 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Relative mRNA levels of gcs-1 and gst-1, both phase II detoxification genes, were elevated compared with levels in N2 animals. Levels of total glutathione was also increased compared to wild type. | Paper_evidence | WBPaper00032399 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00032399 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited lowered fecundity compared to N2 animals, as demonstrated by smaller brood sizes. | Paper_evidence | WBPaper00032399 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000591 | Paper_evidence | WBPaper00032399 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited increased resistance to oxidative-stress causing arsenite (As), and cadmium toxicity. | Paper_evidence | WBPaper00032399 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00032399 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBMol:00004596 | Paper_evidence | WBPaper00032399 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were treated with 10mM Arsenite. | Paper_evidence | WBPaper00032399 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00032399 | ||||||
WBPaper00049105 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2987 | ||||||||
Remark | Animals exhibited reduced mean and median lifespans under various conditions (i.e. temperature and food source) compared to N2 animals. | Paper_evidence | WBPaper00032399 | |||||
Curator_confirmed | WBPerson712 | |||||||
"To test a function of mitochondrial stress signaling in tumor survival during starvation, we used mutants in this signaling pathway, prdx-2(gk169) and aak-2(ok425). After induction of tumor formation by gld-1 RNAi, we performed life span analysis either under feeding (aak-2 and prdx-2; Figure 9B and S6A) or starvation conditions (aak-2 only; Figs 9C and S6B)... Notably, life span under feeding in animals with tumors depends on both aak-2 and prdx-2 function (Fig 9B), whereas starvation-induced life span extension is not affected in the aak-2 mutant (Fig 9C), consistent with recent findings." | Paper_evidence | WBPaper00049105 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Animals were grown on live OP50 or heat-killed OP50. | Paper_evidence | WBPaper00032399 | ||||
Curator_confirmed | WBPerson712 | |||||||
Feeding conditions | Paper_evidence | WBPaper00049105 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Temperature | 15,20 | Paper_evidence | WBPaper00032399 | |||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | gld-1(RNAi) | Paper_evidence | WBPaper00049105 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001621 | Paper_evidence | WBPaper00032399 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed reduced survival after to exposure to 1.0mM hydrogen peroxide compared to wild-type animals; this concentration was sublethal to wild-type animals. | Paper_evidence | WBPaper00032399 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00001695 | Paper_evidence | WBPaper00032399 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001739 | Paper_evidence | WBPaper00032399 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited a more rapid accumulation of the age-associated fluorescent pigment, lipofuscin, in the gut, and a more rapid decline in motility than wild-type animals. | Paper_evidence | WBPaper00032399 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002382 | Paper_evidence | WBPaper00048427 | ||||||
Curator_confirmed | WBPerson11689 | |||||||
Phenotype_assay | Genotype | dvIs19 [Pgst-4::GFP::NLS] | Paper_evidence | WBPaper00048427 | ||||
Curator_confirmed | WBPerson11689 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00050972 | |||||
Curator_confirmed | WBPerson2563 | |||||||
Remark | tested in monoxenic and axenic medium | Paper_evidence | WBPaper00050972 | |||||
Curator_confirmed | WBPerson2563 | |||||||
WBPhenotype:0000146 | Paper_evidence | WBPaper00032399 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited a survival rate at 37C similar to wild-type animals under the same conditions. | Paper_evidence | WBPaper00032399 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032399 | |||||||
WBPaper00046711 | ||||||||
WBPaper00048427 | ||||||||
WBPaper00049105 | ||||||||
WBPaper00050972 | ||||||||
WBPaper00065026 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |