WormBase Tree Display for Variation: WBVar00145606
expand all nodes | collapse all nodes | view schema
WBVar00145606 | Evidence | Paper_evidence | WBPaper00006526 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | gk199 | |||||||
HGVSg | CHROMOSOME_V:g.13193198_13193632del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F57B1 | |||||
Flanking_sequences | aacaacagccataagagtacgtttaaactg | ttgtttcaattaaaataattatgaattaat | |||||||
Mapping_target | F57B1 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | gk199_external | ||||||||
gk199_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035653 | ||||||||
Laboratory | VC | ||||||||
Person | WBPerson427 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006311 | |||||||
Transcript | F57B1.2.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | ?-341 | ||||||||
CDS_position | ?-330 | ||||||||
Protein_position | ?-110 | ||||||||
Exon_number | 1-2/7 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Mapping_data | In_multi_point | 4713 | ||||||
Description | Phenotype | WBPhenotype:0000188 | Paper_evidence | WBPaper00006526 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Gonad size is significantly reduced in adults | Paper_evidence | WBPaper00006526 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00006526 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00006526 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000395 | Paper_evidence | WBPaper00006526 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals lack mature gametes | Paper_evidence | WBPaper00006526 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00006526 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00006526 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000684 | Paper_evidence | WBPaper00006526 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals have reduced numbers of germ cells | Paper_evidence | WBPaper00006526 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00006526 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00006526 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00006526 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | gk199 progeny all developed into adult animals that were sterile | Paper_evidence | WBPaper00006526 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00006526 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00006526 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00006526 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No effect on the localization of Ce-lamin, UNC-84, FG-nucleoporins, Ce-emerin, or Ce-MAN1 in germ-line cells | Paper_evidence | WBPaper00006526 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00006526 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00006526 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Antibody staining to lamin, UNC-84, emerin, MAN-1 and FG nucleoporins | Paper_evidence | WBPaper00006526 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00006526 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |