WormBase Tree Display for Variation: WBVar00145615
expand all nodes | collapse all nodes | view schema
WBVar00145615 | Evidence | Paper_evidence | WBPaper00032077 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | gk208 | |||||||
HGVSg | CHROMOSOME_IV:g.5376892_5377136delinsTTTTTTT | ||||||||
Sequence_details | SMap | S_parent | Sequence | F41H10 | |||||
Flanking_sequences | ctgataacaaagtaggaaaagtgaataaga | cggttttatagttttttagatggaatcgcg | |||||||
Mapping_target | F41H10 | ||||||||
Type_of_mutation | Insertion | TTTTTTT | |||||||
Deletion | |||||||||
PCR_product | gk208_external | ||||||||
gk208_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035748 | ||||||||
Laboratory | VC | ||||||||
Person | WBPerson427 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001243 | |||||||
Transcript | F41H10.7.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | ?-226 | ||||||||
CDS_position | ?-211 | ||||||||
Protein_position | ?-71 | ||||||||
Exon_number | 1-2/6 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Description | Phenotype | WBPhenotype:0000055 | Paper_evidence | WBPaper00024532 | |||||
Curator_confirmed | WBPerson2239 | ||||||||
Remark | elo-5 encodes condensing enzyme (ELO-5) required for biosynthesis of C15 and C17 mono-methyl branched-chain fatty acids from shorter precursors | Paper_evidence | WBPaper00024532 | ||||||
Curator_confirmed | WBPerson2239 | ||||||||
WBPhenotype:0000059 | Paper_evidence | WBPaper00046678 | |||||||
WBPaper00044266 | |||||||||
WBPaper00042436 | |||||||||
Curator_confirmed | WBPerson2239 | ||||||||
WBPerson237 | |||||||||
WBPerson7452 | |||||||||
Remark | Larval arrest suppressed by nprl-3(ku540) | Paper_evidence | WBPaper00042436 | ||||||
Curator_confirmed | WBPerson7452 | ||||||||
Larval arrest was suppressed by dsRNA injection of nprl-2 | Paper_evidence | WBPaper00042436 | |||||||
Curator_confirmed | WBPerson7452 | ||||||||
WBPhenotype:0000081 | Paper_evidence | WBPaper00032077 | |||||||
WBPaper00046678 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2239 | |||||||||
Remark | Mutants cultured on plates seeded with mmBCFA-free bacteria such as OP50, fail to grow past the L3 stage. The elo-5(-) phenotype can be partially rescued by the 1 mM C13ISO supplement and fully rescued at concentrations higher than 2 mM. The C13ISO supplement allowed one generation of elo-5(-) animals depleted for C17ISO to develop into fertile adults. Full rescue can also be achieved by supplementing with certain concentrations of C17ISO; however, F2 progeny of F1 animals uniformly enter L1 diapause. | Paper_evidence | WBPaper00032077 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00032077 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | The homozygous lethal elo-5(lf) strain is maintained on NGM plates seeded with E. coli OP50 mixed with supplementary 1 mM C17ISO dissolved in 10% DMSO (final concentration in bacterial suspension) or on NGM plates seeded with a mixture of OP50 and mmBCFA-producing bacteria Stenotrophomonas maltophilia. | Paper_evidence | WBPaper00032077 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000135 | Paper_evidence | WBPaper00032077 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | acs-1 gene expression in C17ISO deficient animals is significantly increased (~7-fold increase relative to wild-type levels), as determined by qPCR analysis. | Paper_evidence | WBPaper00032077 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | The homozygous lethal elo-5(lf) strain is maintained on NGM plates seeded with E. coli OP50 mixed with supplementary 1 mM C17ISO dissolved in 10% DMSO (final concentration in bacterial suspension) or on NGM plates seeded with a mixture of OP50 and mmBCFA-producing bacteria Stenotrophomonas maltophilia. | Paper_evidence | WBPaper00032077 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000383 | Paper_evidence | WBPaper00032077 | |||||||
WBPaper00042436 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson7452 | |||||||||
Remark | The elongation os C13ISO to C15ISO was drastically reduced in elo-5(lf) animals as determined by GC (data not shown). | Paper_evidence | WBPaper00032077 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
mmBCFA-containing sphingolipids are dramatically reduced | Paper_evidence | WBPaper00042436 | |||||||
Curator_confirmed | WBPerson7452 | ||||||||
Supplementation with d17iso-sphinganine fully rescues L1 arrest | Paper_evidence | WBPaper00042436 | |||||||
Curator_confirmed | WBPerson7452 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00042436 | |||||||
Curator_confirmed | WBPerson7452 | ||||||||
Remark | FIB-1 nucleolar protein was reduced and mislocalized in a diffuse pattern in the DAPI-stained nucleus | Paper_evidence | WBPaper00042436 | ||||||
Curator_confirmed | WBPerson7452 | ||||||||
FIB-1 nucleolar protein level and localization were recovered by nprl-3(ku450) | Paper_evidence | WBPaper00042436 | |||||||
Curator_confirmed | WBPerson7452 | ||||||||
WBPhenotype:0000517 | Paper_evidence | WBPaper00046678 | |||||||
Curator_confirmed | WBPerson2239 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00047025 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | elo-5(gk208) results in mislocalized ERM-1::GFP; ERM-1::GFP is localized to the apical intestinal cell membrane in wild type animals but is diffuse in elo-5(gk208) animals | Paper_evidence | WBPaper00047025 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | ERM-1::GFP | Paper_evidence | WBPaper00047025 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00046678 | |||||||
Curator_confirmed | WBPerson2239 | ||||||||
Phenotype_not_observed | WBPhenotype:0000706 | Paper_evidence | WBPaper00047025 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | elo-5(gk208) animals did not exhibit different numbers of acidified gut granules, as determined by microspcopy following worms' ingestion of LysoTracker Red. (Figure S3H-J) | Paper_evidence | WBPaper00047025 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000778 | Paper_evidence | WBPaper00032077 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrested larva are able to feed as determined by the presence of bright GFP-labeled intact bacterial cells in pharyngeal tube and partially digested bacterial cells in the anterior and posterior part of the intestinal tube of larvae. | Paper_evidence | WBPaper00032077 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | elo-5(lf) adults maintained on S. maltophilia or C17ISO supplements were bleached and the released eggs were placed on E. coli OP50-GFP (CGC) supplemented with C13ISO. The L1 arrested larvae of the next generation were evaluated for uptake and digestion of the bacteria using GFP imaging. | Paper_evidence | WBPaper00032077 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00024532 | ||||||||
WBPaper00032077 | |||||||||
WBPaper00042436 | |||||||||
WBPaper00044266 | |||||||||
WBPaper00046678 | |||||||||
WBPaper00047025 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |