WormBase Tree Display for Variation: WBVar00145619
expand all nodes | collapse all nodes | view schema
WBVar00145619 | Name | Public_name | gk212 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y60A3A.12.1:c.136_694-88del | |||||||
HGVSg | CHROMOSOME_V:g.19914410_19915785del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y60A3A | ||||
Flanking_sequences | aaatcactttttatcgataattttagtgaa | gggttttgaagcagcacactgtgattctcc | ||||||
Mapping_target | Y60A3A | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | gk212_external | |||||||
gk212_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00040537 | |||||||
Laboratory | VC | |||||||
Person | WBPerson427 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000499 | ||||||
Transcript | Y60A3A.12.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y60A3A.12.1:c.136_694-88del | |||||||
cDNA_position | 186-? | |||||||
CDS_position | 136-? | |||||||
Protein_position | 46-? | |||||||
Intron_number | 3-7/15 | |||||||
Exon_number | 3-7/16 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Description | Phenotype | WBPhenotype:0001755 | Paper_evidence | WBPaper00029176 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | UV-C induced mitotic germ cell arrest was reduced in these mutants. | Paper_evidence | WBPaper00029176 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Germ cell apoptosis was measured following exposure to 100 joules per square meter UV-C. | Paper_evidence | WBPaper00029176 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001756 | Paper_evidence | WBPaper00029176 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | chk-2(gk212) mutants failed to exhibit increased germ cell cell death upon UV-C treatment. | Paper_evidence | WBPaper00029176 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Germ cell apoptosis was measured following exposure to 100 joules per square meter UV-C. | Paper_evidence | WBPaper00029176 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00029176 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |