WormBase Tree Display for Variation: WBVar00145621
expand all nodes | collapse all nodes | view schema
WBVar00145621 | Name | Public_name | gk214 | ||||
---|---|---|---|---|---|---|---|
Other_name | F48F7.1a.1:c.23_210+32delinsCTGATATTCTCTG | ||||||
F48F7.1b.1:c.86_273+32delinsCTGATATTCTCTG | |||||||
F48F7.1a.3:c.23_210+32delinsCTGATATTCTCTG | |||||||
F48F7.1a.2:c.23_210+32delinsCTGATATTCTCTG | |||||||
HGVSg | CHROMOSOME_X:g.13951313_13951532delinsCTGATATTCTCTG | ||||||
Sequence_details | SMap | S_parent | Sequence | K02B9 | |||
Flanking_sequences | acgacccaatgtccggcgggccgcaatatt | acatctgatattatcttgttattagtttgt | |||||
Mapping_target | K02B9 | ||||||
Type_of_mutation | Insertion | CTGATATTCTCTG | |||||
Deletion | |||||||
PCR_product | gk214_external | ||||||
gk214_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00033317 | ||||||
WBStrain00035775 | |||||||
Laboratory | VC | ||||||
Person | WBPerson427 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00000105 | |||||
Transcript | F48F7.1b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | F48F7.1b.1:c.86_273+32delinsCTGATATTCTCTG | ||||||
cDNA_position | 86-? | ||||||
CDS_position | 86-? | ||||||
Protein_position | 29-? | ||||||
Intron_number | 2/6 | ||||||
Exon_number | 2/7 | ||||||
F48F7.1a.2 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | F48F7.1a.2:c.23_210+32delinsCTGATATTCTCTG | ||||||
cDNA_position | 465-? | ||||||
CDS_position | 23-? | ||||||
Protein_position | 8-? | ||||||
Intron_number | 3/8 | ||||||
Exon_number | 3/9 | ||||||
F48F7.1a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | F48F7.1a.1:c.23_210+32delinsCTGATATTCTCTG | ||||||
cDNA_position | 52-? | ||||||
CDS_position | 23-? | ||||||
Protein_position | 8-? | ||||||
Intron_number | 2/7 | ||||||
Exon_number | 2/8 | ||||||
F48F7.1a.3 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | F48F7.1a.3:c.23_210+32delinsCTGATATTCTCTG | ||||||
cDNA_position | 1743-? | ||||||
CDS_position | 23-? | ||||||
Protein_position | 8-? | ||||||
Intron_number | 2/7 | ||||||
Exon_number | 2/8 | ||||||
Interactor (21) | |||||||
Isolation | Mutagen | UV/TMP | |||||
Genetics | Mapping_data | In_multi_point | 4153 | ||||
Description | Phenotype (13) | ||||||
Phenotype_not_observed | WBPhenotype:0001371 | Paper_evidence | WBPaper00029211 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Both wild-type extract and alg-1(gk214) (result not shown) are capable of forming a ribonucleoprotein (RNP) complex with the pre-let-7. | Paper_evidence | WBPaper00029211 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002155 | Paper_evidence | WBPaper00029211 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | alg-1(gk214) extracts show that pre-let-7 is processed normally. | Paper_evidence | WBPaper00029211 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference (11) | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |