WormBase Tree Display for Variation: WBVar00145634
expand all nodes | collapse all nodes | view schema
WBVar00145634 | Evidence | Paper_evidence | WBPaper00032446 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | gk227 | ||||||
Other_name | F59F3.1.1:c.94-52_313del | |||||||
HGVSg | CHROMOSOME_X:g.10992957_10993292del | |||||||
Sequence_details | SMap | S_parent | Sequence | F59F3 | ||||
Flanking_sequences | aatttgaaattaagggcatagaatacataa | ctggaacatattcatgctcttcaatggaac | ||||||
Mapping_target | F59F3 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | gk227_external | |||||||
gk227_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035773 | |||||||
Laboratory | VC | |||||||
Person | WBPerson427 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006896 | ||||||
Transcript | F59F3.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F59F3.1.1:c.94-52_313del | |||||||
cDNA_position | ?-367 | |||||||
CDS_position | ?-313 | |||||||
Protein_position | ?-105 | |||||||
Intron_number | 2-3/15 | |||||||
Exon_number | 3-4/16 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Mapping_data | In_multi_point | 4751 | |||||
Description | Phenotype_not_observed | WBPhenotype:0001524 | Paper_evidence | WBPaper00036308 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | 0% of ver-3(gk227) animals were resistant to EGF-induced sleep (Table 1) | Paper_evidence | WBPaper00036308 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Animals carrying the hs:LIN-3 transgene were well fed and grown at 20C. Young adult animals were scored 2 hours after heat shock for EGF-induced sleep behavior (see Materials and methods). | Paper_evidence | WBPaper00036308 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Genotype | hs:LIN-3 | Paper_evidence | WBPaper00036308 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00032446 | |||||||
WBPaper00036308 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |