WormBase Tree Display for Variation: WBVar00145675
expand all nodes | collapse all nodes | view schema
WBVar00145675 | Evidence | Paper_evidence | WBPaper00035961 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | gk268 | ||||||
HGVSg | CHROMOSOME_III:g.675515_677052del | |||||||
Sequence_details | SMap | S_parent | Sequence | W02B3 | ||||
Flanking_sequences | ttccattccccctcctttcccaagtcagta | gcacggtcttaagcataaaaaataagttga | ||||||
Mapping_target | W02B3 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | gk268_external | |||||||
gk268_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00007481 | |||||||
WBStrain00030533 | ||||||||
WBStrain00035834 | ||||||||
WBStrain00055927 | ||||||||
WBStrain00055928 | ||||||||
WBStrain00055929 | ||||||||
WBStrain00055933 | ||||||||
Laboratory | VC | |||||||
JN | ||||||||
Person | WBPerson427 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene (2) | |||||||
Transcript | W02B3.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2-4/10 | |||||||
Exon_number | 1-4/11 | |||||||
W02B3.8 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
Interactor (39) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Description | Phenotype (16) | |||||||
Phenotype_not_observed | WBPhenotype:0000274 | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Because we did not observe a significant number of unfertilized eggs or dead embryos in the grk-2 mutant strains, this suggests that the sperm capacity and development of embryos are normal in these strains." | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000357 | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Because we did not observe a significant number of unfertilized eggs or dead embryos in the grk-2 mutant strains, this suggests that the sperm capacity and development of embryos are normal in these strains." | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "To determine whether there were any changes in 5-HT synthesis, we measured tph-1 expression in N2 and grk-2 mutants by generating transgenic strains expressing GFP using the tph-1 promoter (tph-1::GFP). No differences in tph-1::GFP expression were observed in the N2 and grk-2 mutant strains as assessed by fluorescence (data not shown). We also evaluated TPH-1 using a mammalian Tph1 antibody and found that TPH-1 protein levels are similar in wild type and grk-2 mutants at several developmental stages (Fig. 4B)." | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Although there was no difference in the brood size between N2 and grk-2 mutants (Fig. 1D), a significant number of the laid eggs were late stage in the grk-2 loss-of-function strains (Fig. 1E)." | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050796 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (5) | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |