WormBase Tree Display for Variation: WBVar00145709
expand all nodes | collapse all nodes | view schema
WBVar00145709 | Name | Public_name | gk302 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F26B1.7.1:c.258+35_497del | ||||||||
HGVSg | CHROMOSOME_I:g.6322674_6323210del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F26B1 | |||||
Flanking_sequences | ctctttctggccttgtatccacgtggacga | taccttaaaaatgcgttcttgagggaaaac | |||||||
Mapping_target | F26B1 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | gk302_external | ||||||||
gk302_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035996 | ||||||||
Laboratory | VC | ||||||||
Person | WBPerson427 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002601 | |||||||
Transcript | F26B1.7.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F26B1.7.1:c.258+35_497del | ||||||||
cDNA_position | ?-533 | ||||||||
CDS_position | ?-497 | ||||||||
Protein_position | ?-166 | ||||||||
Intron_number | 3-4/8 | ||||||||
Exon_number | 4-5/9 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00036106 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Homozygous mutants are embryonic lethal | Paper_evidence | WBPaper00036106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000095 | Paper_evidence | WBPaper00036106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants displayed M lineage phenotypes | Paper_evidence | WBPaper00036106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00036106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals have extra egl-15::gfp-positive sex muscles | Paper_evidence | WBPaper00036106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00036106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Some mutants survive to become sterile adults | Paper_evidence | WBPaper00036106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000852 | Paper_evidence | WBPaper00036106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals lack functional embryonic and M-derived CCs | Paper_evidence | WBPaper00036106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | animals did not exhibit abnormal gland cell projections | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005788 | PATO:0000460 | Paper_evidence | WBPaper00040002 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00040002 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00040002 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040002 | ||||||||
WBPaper00036106 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |