WormBase Tree Display for Variation: WBVar00145722
expand all nodes | collapse all nodes | view schema
WBVar00145722 | Name | Public_name | gk315 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | ZC8.3.1:c.225+103_856del | ||||||||
HGVSg | CHROMOSOME_X:g.4999651_5000788del | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC8 | |||||
Flanking_sequences | ttttcattcattcatttcttctataaatga | cagaatatcgaaaaacaattaaactacatg | |||||||
Mapping_target | ZC8 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | gk315_external | ||||||||
gk315_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00036009 | ||||||||
Laboratory | VC | ||||||||
Person | WBPerson427 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00022499 | |||||||
Transcript | ZC8.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC8.3.1:c.225+103_856del | ||||||||
cDNA_position | ?-863 | ||||||||
CDS_position | ?-856 | ||||||||
Protein_position | ?-286 | ||||||||
Intron_number | 3-7/11 | ||||||||
Exon_number | 4-8/12 | ||||||||
Interactor | WBInteraction000521297 | ||||||||
WBInteraction000521430 | |||||||||
WBInteraction000521432 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Mapping_data | In_multi_point | 4925 | ||||||
Description | Phenotype | WBPhenotype:0001785 | Paper_evidence | WBPaper00046360 | |||||
Curator_confirmed | WBPerson3142 | ||||||||
WBPhenotype:0002078 | Paper_evidence | WBPaper00045092 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In vivo, early larval stage L1 and L2 (but not L3 and L4) set-30 mutant worms displayed lower H3K4me levels. | Paper_evidence | WBPaper00045092 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00045092 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00045092 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00049012 | ||||||
Curator_confirmed | WBPerson11446 | ||||||||
Remark | these mutant worms all have normal life spans | Paper_evidence | WBPaper00049012 | ||||||
Curator_confirmed | WBPerson11446 | ||||||||
Reference | WBPaper00045092 | ||||||||
WBPaper00046360 | |||||||||
WBPaper00049012 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |