WormBase Tree Display for Variation: WBVar00145737
expand all nodes | collapse all nodes | view schema
WBVar00145737 | Name | Public_name | gk330 | ||||
---|---|---|---|---|---|---|---|
Other_name | D2021.2a.1:c.724+5_1101-15del | ||||||
HGVSg | CHROMOSOME_X:g.8553778_8554569del | ||||||
Sequence_details | SMap | S_parent | Sequence | D2021 | |||
Flanking_sequences | gacgatcaaaagtccacaaatcctaggtaa | gtgaataattttagaatagggacactggat | |||||
Mapping_target | D2021 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | gk330_external | ||||||
gk330_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00036054 | ||||||
Laboratory | VC | ||||||
Person | WBPerson427 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00044071 | |||||
Transcript | D2021.2b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
Intron_number | 1/4 | ||||||
Exon_number | 1/5 | ||||||
D2021.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | D2021.2a.1:c.724+5_1101-15del | ||||||
Intron_number | 6-8/12 | ||||||
Exon_number | 7-8/13 | ||||||
Isolation | Mutagen | TMP/UV | |||||
Genetics | Mapping_data | In_multi_point | 5569 | ||||
Description | Phenotype | WBPhenotype:0000039 | Paper_evidence | WBPaper00045834 | |||
Curator_confirmed | WBPerson2987 | ||||||
Remark | dhhc-14(gk330) mutants showed a decrease in mean and median lifespan and a reduced time to 90% mortality. (Table 2, Figure 4A) | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Additional file 12 | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Animals did not show a significant difference in age-related decline of thrashing rate, compared to wild type (N2) controls (Additional file 9) | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001700 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Figure 3 A-B | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001726 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Wild-type N2 animals had an average length of 1222 μm and width of 78 μm (Additional file 6). Mutants for dhhc-14(gk330) showed no significant changes in body length or width. | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001727 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Wild-type N2 animals had an average length of 1222 μm and width of 78 μm (Additional file 6). Mutants for dhhc-14(gk330) showed no significant changes in body length or width. | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Additional file 8 | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference | WBPaper00045834 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |