WormBase Tree Display for Variation: WBVar00145911
expand all nodes | collapse all nodes | view schema
WBVar00145911 | Name | Public_name | gk541 | ||
---|---|---|---|---|---|
HGVSg | CHROMOSOME_II:g.10539075_10539462delinsGATTAAACT | ||||
Sequence_details | SMap | S_parent | Sequence | R166 | |
Flanking_sequences | cgaatttttatttgagaattgattaaactt | ttaaaacaaaaacaacagaaaaagatcaac | |||
Mapping_target | R166 | ||||
Type_of_mutation | Insertion | GATTAAACT | |||
Deletion | |||||
PCR_product | GK541_external | ||||
GK541_internal | |||||
SeqStatus | Sequenced | ||||
Deletion_verification | PCR with one primer internal to the deletion and one external confirms that no WT copy of the gene remains. | Person_evidence | WBPerson154 | ||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036354 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00011303 | |||
WBGene00004185 | |||||
Transcript | R166.4.1 | VEP_consequence | 3_prime_UTR_variant | ||
VEP_impact | MODIFIER | ||||
cDNA_position | 1688-? | ||||
Exon_number | 6/6 | ||||
R166.3.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
Intron_number | 1/5 | ||||
Exon_number | 1/6 | ||||
Isolation | Mutagen | UV/TMP | |||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
Method | KO_consortium_allele |