WormBase Tree Display for Variation: WBVar00145917
expand all nodes | collapse all nodes | view schema
| WBVar00145917 | Name | Public_name | gk549 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | F57A10.3.1:c.1060+246_1389-239del | ||||||||
| HGVSg | CHROMOSOME_V:g.15762749_15763889del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F57A10 | |||||
| Flanking_sequences | ttttttaataagtttaatcacatttttcgg | gtaatttctctttttttttaaaaagacttt | |||||||
| Mapping_target | F57A10 | ||||||||
| Type_of_mutation | Deletion | ||||||||
| PCR_product | gk549_external | ||||||||
| gk549_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Deletion_verification | PCR with one primer internal to the deletion and one external confirms that no WT copy of the gene remains. | Person_evidence | WBPerson154 | ||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00036397 | ||||||||
| Laboratory | VC | ||||||||
| Person | WBPerson427 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001813 | |||||||
| WBGene00201841 | |||||||||
| Transcript | F57A10.9 | VEP_consequence | transcript_ablation | ||||||
| VEP_impact | HIGH | ||||||||
| Exon_number | 1/1 | ||||||||
| F57A10.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F57A10.3.1:c.1060+246_1389-239del | ||||||||
| Intron_number | 8-10/15 | ||||||||
| Exon_number | 9-10/16 | ||||||||
| Interactor | WBInteraction000537506 | ||||||||
| Isolation | Mutagen | UV/TMP | |||||||
| Description | Phenotype_not_observed | WBPhenotype:0002423 | Paper_evidence | WBPaper00049307 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Mutations in ABC transporters for other organelles such as haf-2 and haf-3 did not suppress m-nonN-Nmnat1 protection against hypoxia (Supplementary Figure S4b)." | Paper_evidence | WBPaper00049307 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | GO_term | GO:0001666 | PATO:0000460 | Paper_evidence | WBPaper00049307 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | gcIs30[Neuro-m-nonN-Nmnat1] | Paper_evidence | WBPaper00049307 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00049307 | ||||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
| Method | KO_consortium_allele |
