WormBase Tree Display for Variation: WBVar00145990
expand all nodes | collapse all nodes | view schema
WBVar00145990 | Name | Public_name | gk659 | ||
---|---|---|---|---|---|
Other_name | CE39521:p.Ser22_Ter276delextTer? | ||||
VC5.5.1:c.64_828del | |||||
HGVSg | CHROMOSOME_V:g.7092068_7093667del | ||||
Sequence_details | SMap | S_parent | Sequence | VC5 | |
Flanking_sequences | gatttcgatgctttgatcgctaagcccgtc | tctagagccaaagtgacactcattggcagg | |||
Mapping_target | VC5 | ||||
Type_of_mutation | Deletion | ||||
PCR_product | gk659_external | ||||
gk659_internal | |||||
SeqStatus | Sequenced | ||||
Deletion_verification | PCR with one primer internal to the deletion and one external confirms that no WT copy of the gene remains. | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036579 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00003725 | |||
Transcript | VC5.5.1 (11) | ||||
Isolation | Mutagen | UV/TMP | |||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
Method | KO_consortium_allele |