WormBase Tree Display for Variation: WBVar00145990
expand all nodes | collapse all nodes | view schema
| WBVar00145990 | Name | Public_name | gk659 | ||
|---|---|---|---|---|---|
| Other_name | CE39521:p.Ser22_Ter276delextTer? | ||||
| VC5.5.1:c.64_828del | |||||
| HGVSg | CHROMOSOME_V:g.7092068_7093667del | ||||
| Sequence_details | SMap | S_parent | Sequence | VC5 | |
| Flanking_sequences | gatttcgatgctttgatcgctaagcccgtc | tctagagccaaagtgacactcattggcagg | |||
| Mapping_target | VC5 | ||||
| Type_of_mutation | Deletion | ||||
| PCR_product | gk659_external | ||||
| gk659_internal | |||||
| SeqStatus | Sequenced | ||||
| Deletion_verification | PCR with one primer internal to the deletion and one external confirms that no WT copy of the gene remains. | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00036579 | ||||
| Laboratory | VC | ||||
| Person | WBPerson427 | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00003725 | |||
| Transcript | VC5.5.1 (11) | ||||
| Isolation | Mutagen | UV/TMP | |||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
| Method | KO_consortium_allele |
