WormBase Tree Display for Variation: WBVar00146007
expand all nodes | collapse all nodes | view schema
| WBVar00146007 | Name | Public_name | gk679 | ||
|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_I:g.8502476_8502983delinsA | ||||
| Sequence_details | SMap | S_parent | Sequence | K02B12 | |
| Flanking_sequences | agcggtctttctgcgtctcgtctagccacc | gttacgtattgacaacctggtgaaaaatct | |||
| Mapping_target | K02B12 | ||||
| Type_of_mutation | Insertion | A | |||
| Deletion | |||||
| PCR_product | gk679_external | ||||
| gk679_internal | |||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00036629 | ||||
| Laboratory | VC | ||||
| Person | WBPerson427 | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00000431 | |||
| Transcript | K02B12.1.1 | VEP_consequence | 5_prime_UTR_variant | ||
| VEP_impact | MODIFIER | ||||
| cDNA_position | ?-129 | ||||
| Exon_number | 1/8 | ||||
| Isolation | Mutagen | UV/TMP | |||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000431 Genomic_neighbourhood | |||||
| Method | KO_consortium_allele |
