WormBase Tree Display for Variation: WBVar00146007
expand all nodes | collapse all nodes | view schema
WBVar00146007 | Name | Public_name | gk679 | ||
---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.8502476_8502983delinsA | ||||
Sequence_details | SMap | S_parent | Sequence | K02B12 | |
Flanking_sequences | agcggtctttctgcgtctcgtctagccacc | gttacgtattgacaacctggtgaaaaatct | |||
Mapping_target | K02B12 | ||||
Type_of_mutation | Insertion | A | |||
Deletion | |||||
PCR_product | gk679_external | ||||
gk679_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036629 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00000431 | |||
Transcript | K02B12.1.1 | VEP_consequence | 5_prime_UTR_variant | ||
VEP_impact | MODIFIER | ||||
cDNA_position | ?-129 | ||||
Exon_number | 1/8 | ||||
Isolation | Mutagen | UV/TMP | |||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000431 Genomic_neighbourhood | |||||
Method | KO_consortium_allele |