WormBase Tree Display for Variation: WBVar00146285
expand all nodes | collapse all nodes | view schema
WBVar00146285 | Name | Public_name | gk1149 | ||||
---|---|---|---|---|---|---|---|
Other_name | F37E3.3.1:c.463_876del | ||||||
CE09999:p.Asp155_Ter292delextTer? | |||||||
HGVSg | CHROMOSOME_I:g.6430084_6430885del | ||||||
Sequence_details | SMap | S_parent | Sequence | F37E3 | |||
Flanking_sequences | caatccgctagcaccattgaacaccaactc | ctgcgattgaattttcttatctttgattct | |||||
Mapping_target | F37E3 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | gk1149_external | ||||||
gk1149_internal | |||||||
SeqStatus | Sequenced | ||||||
Deletion_verification | Validated by CGH | Laboratory_evidence | VC | ||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00037386 | ||||||
Laboratory | VC | ||||||
Person | WBPerson427 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00305401 | |||||
WBGene00018158 | |||||||
Transcript | F37E3.3.1 (11) | ||||||
F37E3.6 | |||||||
Isolation | Mutagen | UV/TMP | |||||
Description | Phenotype | WBPhenotype:0000863 | Paper_evidence | WBPaper00059171 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | matings yield a decreased percentage of cross progeny (Hansen et al. 2015)(Fig. 1E) | Paper_evidence | WBPaper00059171 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00059171 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |