WormBase Tree Display for Variation: WBVar00146295
expand all nodes | collapse all nodes | view schema
WBVar00146295 | Name | Public_name | gk1190 | ||
---|---|---|---|---|---|
Other_name | R11G1.6a.1:c.77_247+31del | ||||
R11G1.6b.1:c.77_247+31del | |||||
HGVSg | CHROMOSOME_X:g.3644578_3644779del | ||||
Sequence_details | SMap | S_parent | Sequence | R11G1 | |
Flanking_sequences | GCATTTAAGTAAGTTAGTGTAATGTATTTT | ACACTTTTTCTTGAAATTGTTTGGCATGAT | |||
Mapping_target | R11G1 | ||||
CGH_deleted_probes | AAAACAATGAGTACGGATTCAAAAATAAAACCTTGTAGGAAACTTGTGTA | GGATTCGATGGCATCTGTATAGAGTTGAATGGCATAATTATAGGCATTTA | |||
Type_of_mutation | Deletion | ||||
PCR_product | GK1190_external | ||||
GK1190_internal | |||||
SeqStatus | Sequenced | ||||
Deletion_verification | Deletion confirmed by PCR. | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037974 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Detection_method | Oligo Array CGH | ||||
Status | Live | ||||
Affects | Gene | WBGene00020012 | |||
Transcript | R11G1.6b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||
VEP_impact | HIGH | ||||
HGVSc | R11G1.6b.1:c.77_247+31del | ||||
cDNA_position | 107-? | ||||
CDS_position | 77-? | ||||
Protein_position | 26-? | ||||
Intron_number | 2/16 | ||||
Exon_number | 2/17 | ||||
R11G1.6a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | R11G1.6a.1:c.77_247+31del | ||||
cDNA_position | 118-? | ||||
CDS_position | 77-? | ||||
Protein_position | 26-? | ||||
Intron_number | 2/16 | ||||
Exon_number | 2/17 | ||||
Genetics | Interpolated_map_position | X | -9.91238 | ||
Remark | Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. | ||||
Method | Deletion_allele |