WormBase Tree Display for Variation: WBVar00146356
expand all nodes | collapse all nodes | view schema
WBVar00146356 | Evidence | Paper_evidence | WBPaper00002850 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | F54G8 | |||
Flanking_sequences | atgcagctttcgttgaaacatctgctgatc | tgataggcctacaattggtgggttttttga | |||||
Mapping_target | F54G8 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002850 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00028742 | ||||||
Laboratory | NG | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00002081 | |||||
Transcript | F54G8.3.1 (12) | ||||||
Interactor | WBInteraction000503959 | ||||||
Genetics | Interpolated_map_position | III | 0.270678 | ||||
Description | Phenotype (12) | ||||||
Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00035117 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | The polarity of the invasive membrane components was normal in ina-1(gm144) mutants | Paper_evidence | WBPaper00035117 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035117 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000163 | Paper_evidence | WBPaper00002978 | |||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0000241 | Paper_evidence | WBPaper00004897 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | No accumulation of dead cell corpses | Paper_evidence | WBPaper00004897 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00002978 | |||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00035117 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | ina-1(gm144) animals had normal AC invasion | Paper_evidence | WBPaper00035117 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035117 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Disease_info | Models_disease | DOID:1826 | |||||
Models_disease_in_annotation | WBDOannot00000556 | ||||||
Reference | WBPaper00002978 | ||||||
WBPaper00004897 | |||||||
WBPaper00035198 | |||||||
WBPaper00032026 | |||||||
WBPaper00035117 | |||||||
WBPaper00006471 | |||||||
Method | Substitution_allele |